Menu

Qmotors отзывы: Отзывы от клиентов Кволити Моторс. Видео отзывы об автосервисе Кволити Моторс в Москве

Содержание

10 отзывов о СТО QMotors, Киев, ул. Березняковская 29-б (109 бокс)

Заметили ошибку в описании? Сообщите, исправим!

  • Рейтинг: 2.5 из 5 29.01.2017 Майя на Тойота Прадо
    Время визита: 25 января 2017

    Здесь работает хороший мастер Сергей. Я пригоняла к нему Тайоту Прада на полировку кузова и перестановку биксиноновых линз на фары. Делает быстро и качественно. Советую его как мастера.

  • Рейтинг: 2.5 из 5 4.01.2017 Kateruna на Лансер 10

    Время визита: 1 ноября 2016

    Здравствуйте я уже три года езжу на ето СТО и мне все нравится.
    Я ставила линзи та партроник на три машины на хундай елантра, Шкода Октавия та Лансер 10, мне ето всьо делал мастер Сергей у него золотые руки.
    Вот что я скажу я рекомендую ето СТО QMotors по улице Березняковский 29б.

    А то что пишут плохое про ето СТО просто вранье)))))))

  • Рейтинг: 2.5 из 5 8.06.2015 Виктор

    Время визита: 6.06.2015

    Знаю это СТО с 2011 года, в данной компании 4 раза ставил линзы биксенон на разные автомобили. Делал Шевроле Круз, Хюндай Элантра MD, Субару форестер, Hоnda Accord. Посмотреть работу можно в моём бортовике на Drive2.ru —
    http://www.drive2.ru/l/4899916394579204852/
    http://www.drive2.ru/l/168783/
    Цена и качество хорошие, оборудование нормально работает уже 4 года, претензий нет. Касательно чистоты и отношения к машине и оптике, я всегда мою машину мотор перед такими ответственными работами. Не смотря на уровень мастеров, настаиваю на оклейке стекла фары защитным скотчем, можно использовать малярный бумажный скотч. Данные меры позволяют избавится от случайных царапин при разборке и защитят ваши нервы и товарный вид фары. 🙂 Пыли и песка после работы не обнаружено, я специально акцентирую внимание на отпечатках пальцев и пыли. Перед установкой рекомендую осмотреть линзы, так вы 100% будите уверены в качестве приобретаемого товара. Линзы и корпус маски нельзя трогать грязными и жирными руками, удалить отпечатки крайне сложно, для этого используйте ткань или перчатки. Из минусов этой компании, это отсутствие стенда по настройке высоты фар. Но решается это просто, перед поездкой на СТО, найдите место в паркинге или гараже и замерьте высоту штатного света, после установки всегда можно подъехать на это место и отрегулировать в ручную свет. Если не хотите ничего крутить, езжайте на Bosch Автолайф, там за 30 минут всё выставят согласно ПДД. Присутствие при разборке фар и авто желательно, так Вы 100% увидите результат. Если вас что-то смущает, всегда можно обратится к директору Андрею, он адекватный и нормальный человек, проблем лично у меня с данным СТО нет. Работы по установке линз биксенон в данном месте я рекомендую! Человеческий фактор не исключаю, поэтому ставьте задачу и требуйте ей исполнения, деньги то ваши!

    Сейчас тут ставлю линзы на Хюндай Туксон 2008 года, после выложу фото и отзывы.

  • Рейтинг: 2.5 из 5 3.09.2014 Коля на Jeep

    Время визита: 09.06.13.

    Этих малолеток давно нужно закрыть!!!!! Как то я приезжал на химчистку салона, сказали что будет все хорошо и успеют за 4-5 часов!!!! Я был в шоке когда увидел свою машину, вонь ужасная, салон мокрый, мне хотелось им руки поотрывать!!!! Покричал немного вернули пол суммы и уехал!!! За то у них дешевле! Не советую к ним обращаться!!!

    3.09.2014 ответ автосервиса (Андрей)

    Не надо врать… Не делали мы химчистку на jeep. Все автомобили записаны за последние 3 года!!!

  • Рейтинг: 2.5 из 5 17.08.2014 Евгений на Ford
    Время визита: 17.08.2014

    У меня была вибрация при торможении. Отдавало в педаль тормоза. По телефону объяснил, что так и так, необходима проверка на биение дисков, барабанов и ступиц сказали хорошо, записался, приехал.
    Говорили около часа, в итоге через два часа мне заявляют: Может быть передние диски, может задние тормозные барабаны, а в акте написали, что типо под замену передние диски и колодки (дискам 10тыс км, а колодки и 300км не проехали). На вопрос, а как вы мерили, где цифры, где отклонения, что за может еще нафиг!!!!?. Они такие: ну мы не измеряли ничего, на глаз все.
    Что за ужас!!!??? Они за это берут 1600р и занимает это два часа!!!
    Я блин купил диски новые передние, поменял — вибрация осталась!!! Приехали, хорошо хоть деньги вернули, за это 1 они может и заслуживают.

    Отвратительно!! А почитал в интервенте, хорошие отзывы везде, ужас

    Дополнение от 17.08.2014:
    Этот сервис в Москве на Удальцова, 60

    17.08.2014 ответ автосервиса ()

    Это не наше СТО!!!
    Мы находимся в другой стране!
    И ходовую тоже не ремонтируем!

  • Рейтинг: 2.5 из 5 14.06.2014 Сергей на Daewoo
    Время визита: Июнь 2014

    Что сказать… Такого уж кошмара я не ощутил, наверное потому что рассчитывал на наш отечественный сервис и то, как дорожат клиентами. Ставил линзы, я опускаю то, что не смогли распаковать фары, которые я собрался ставить вместо своих… Ладно, согласился ставить в родные. Когда я пришел забрать машину, уже было темно и как раз можно посмотреть результат… Машина стоит в сторонке, типа «готова, принимайте работу». Щас… Открываю дверь, а ручка грязная (чистыми руками сразу чувствуется), ладно, думаю, протру потом. Взялся за руль, а там как будто колесо на внедорожнике после лесного ралли по грязи. То же самое с рычагом переключения передач, ручником и брелком. Ни один уважающий себя сервис не оставил бы клиенту ГОТОВУЮ машину с грязным рулем и т. д. По поводу работы — включаю свет, а он в небо, я говорю мол обещали отрегулировать. «Мы отрегулировали, так и должно быть». Корректоры не работают, вгружали мне что я раздолбал защелку корректора в фаре. Короче покопались немного еще, так и ничего не сделали. Так и поехал… Приехал, сделал всю ихнюю работу сам у себя в гараже. В итоге свет светит туда, куда надо, корректоры работают оба как надо (это ж надо было придумать, что я раздолбал защелку вместо того чтобы правильно защелкнуть их). Вывод: всё зависит от мозгов мастера и желания работать. Они сделали много машин, а элементарных вещей не знают (не знают даже как должен ближний светить). И не смогли фары просто правильно (с мозгами) отрегулировать. Это квалификация? Это просто «фикация» и ничего другого

  • Рейтинг: 2.5 из 5 1.02.2014 Сергей на Ford
    Время визита: 8.12.2013

    Если Вам дорого Ваше время, деньги, а главное нервы — то не обращайтесь на qmotors, ужасные специалисты! Надеюсь мой отзыв спасет кому то нервы.

  • Рейтинг: 2.5 из 5 11.09.2013 Vic на Hyundai
    Время визита: август 2013

    Напишу и я свой отзыв про данное сто. Обратился к ним с установкой линз на Элантру МД. Линзы были мои, не такие как ихние. У меня 3 дюйма (реплика Които), у них 2,5 Моримото. Уговаривали ставить их линзы, но то такое. В самом начале немного смутило, что фару грели не полностью и равномерно, а феном локально по шву. В итоге шов сейчас как порванный, где-то пазы сломаны, где-то подплавленны, где-то изогнуты. В одном месте стекло задето температурой и видны в нём пузырьки. Но самое печальное, что в левой фаре линзу прикрутили не совсем правильно и при попытке поднять её выше, электрический корректор долго гудел и в итоге вышел из строя. На это гудение был ответ «это линза тяжелая, нужно было наши ставить, корректор не может ее поднять». Это при том, что правая фара работает нормально. При вопросе приехать к ним с этой проблемой еще раз, мне сказали за доплату. При сборке фары, линзу трогали руками, на ней остались следы. На моё замечание о грязной линзе был ответ «та то выгорит!». Отдал за установку больше чем они обычно берут, наверное только потому, что пришлось подпилить немного две маски из-за нестандартной формы отражателя. Далее обнаружилось, что одно нижнее крепление (защелка) правой фары сломано.
    ИТОГ: Результата 0, «порванные» швы фар, не правильно установлена одна линза, сломанный из-за этого электро-корректор, сломанное одно крепление правой фары. Устранение всего этого повлечет явно немало денег и уж точно больше, чем стоит обычная установка! Хотя казалось бы — не такая уже и сложная работа — поставить две линзы!

    Данное сто я НЕ рекомендую

    12.09.2013 ответ автосервиса (Андрей)

    Добрый день.
    По поводу того что линза была установлена неправильно что это неправда… у линзы в комплекте есть специальные установочные переходники, которые очень четко становятся в посадочное место галогеновой лампы и направляют линзу.
    1 вариант. Если линзу поставить неправильно (не попасть в эти пазы) то она будет светить очень криво. У Вас ДВЕ линзы светили ровно и на одной линии.
    2 вариант. Линзу можно не затянуть до конца. Но тогда она просто провисла. и болтаясь никак не могла бы сломать корректор при попытке поднятия фар вверх.
    Проблема заключается в том что у Вас линзы 3х дюймовые плюс они очень сильно выдвинуты вперед к стеклу фары — а это очень сильно смещает центр тяжести и увеличивает нагрузку на корректор.
    Мы поставили на около 15ти Элантр (везде ставили 2,5 дюйма) и никаких проблем. Вторая фара может так проездить и 5 лет а может упасть корректор и сегодня.
    По поводу оплаты. Вы оплатили стандартную стоимость установки + 50 грн. за то что Ваши линзы не помещались в фару + наше реле (КОТОРОГО ВАШИ ПРОДАВЦЫ ВАМ ПРОСТО НЕ ДАЛИ!!!)
    По поводу грязной линзы. Надо было звонить напрямую мне, а приезжать посреди дня без звонка (когда все были заняты), но Вас приняли. Вам наново и бесплатно разбирали фару.
    По поводу того что Вам говорили что что то будет на следующий раз платно это неправильно.
    Пожалуйста для решения данной ситуации позвоните мне в удобное Вам время. т. 044 361-29-78.
    Мы ценим своих клиентов и никогда никому не отказывали в гарантийном обслуживании.

  • Рейтинг: 2.5 из 5 19.03.2013 Валерий на Mazda 6
    Время визита: весна 2013

    На так называемом СТО работают криворукие малолетки,которые ничего не умеют делать,умеют только портить!Возрастом до 20 лет.Устанавливал у них ксенон,торгуют самым низко-качественным ксеноном(подделкой),ксенон весь без коробок и гравировок фирм производителей,когда установили ксенон-1-ну фару забыли закрутить вовсе,заметил когда приехал домой,хорошо что не потерял ее по дороге.Ксенон перестал работать через неделю(в одной фаре),не знаю в чем проблема.Работу делают некачественно до ужаса,блоки розжига не прикрутили,положили сбоку фары(теперь они тарабанят),все сделано неаккуратно(везде торчат какие-то скрутки обмотанные изо-лентой).Позвонил так называемому начальнику Андрею Дуде,обещал набрать когда будет время,чтоб посмотреть что там у меня не так.Жду уже неделю,видимо эму это не надо,деньги ведь я заплатил в прошлый раз.В итого света нету,и денег за установку ксенона тоже.Все покупал у них,чтоб была гарантия на установку и на сам ксенон.Перед установкой этот Андрей мне обещал и гарантию на ксенон,и на установку,и говорил что все будет в лучшем виде.Это СТО не дорожит своей репутацией и клиентами!Хозяин набрал иногородних малолеток которые ничего не умеют делать и платит им за это копейки,а сам таким образом зарабатывает,так как стоимость работ у них такая как на профеcсиональном СТО где в отличие от них умеют это делать и дают гарантию на свои услуги!
    Обьезжайте это горе СТО 10-й дорогой!!!Поеду делать свой свет к нормальным мастерам!

    19.03.2013 ответ автосервиса (Андрей)

    Добрый день.
    Я представитель компании Qmotors.
    Читая этот отзыв мы не могли не отреагировать на него. Этот отзыв полностью построен на лжи. Я не буду углубляться в догадки кто его написал (недобросовестный конкурент или чем-то недоволен клиент), хотя бы из-за соображений что человек не написал ни одного факта. Я разложу каждый пункт по полочкам что бы доказать о неправоте и не правдивости данного отзыва.
    1 — торгуют самым низко-качественным ксеноном. – хотелось бы знать какой ксенон мы Вам устанавливали (хотя есть сомнения что мы Вам вообще что-то ставили). У на большой ассортимент ксенона и заявления что мы торгуем только самим плохим ксеноном неправдиво… у нас есть дешевый ксенон (Sho-me, mitsumi, cyclon), но он не плохой и у большинства эти комплекты служат годами. Также у нас есть среднего качества ксенон (vintage, falcon, mitsumi slim….), есть infolight, infolight expert, Mlux (это хороший качественный ксенон с очень низким процентом выхода из строя (менее 1% за первый год эксплуатации)), не и наконец Kaixen и Kaixen extreme…. Стоимость которого 270-420 у.е. как такой ксенон может быть некачественным?
    2 — весь без коробок и гравировок фирм производителей. Вся продукция оригинальна (на блоках Sho-me, vintage, falcone, infolight, infolight expert, Mlux есть гравировки) у нас нет подделок, мы не клеем на дешевые блоки наклейки infolihgt, bosh, hella и.т.д. (как это делается на Перова и многих других СТО). У нас только оригинальная продукция которую можно легко отличить и на каждом блоке, лампе, парктронике…. Есть гарантийный стикер оф. Фирмы.
    По поводу того что у нас много товара не упакованы комплектами… Да это действительно так, но почему? У нас большой ассортимент, у нас все в наличии….Благодаря несложными подсчетам видим: берем ассортимент 10 видов (хотя у нас он намного больше) и умножаем на 9 самых популярных цоколей ламп (h2, h4, h7, h21, h37, 9005, 9006, 9007, h5) потом умножаем на 3 цветовых температуры (4300к, 5000к, 6000К) и еще умножаем хотя бы на 2 комплекта (вдруг клиент захочет поставить сразу в ближний и в ПТФ). 10*9*3*2=540 комплектов. А это: 1 — по отовым ценам приблизительно 35 000 у.е., 2 – это надо отдельное помещение под склад, 3 – есть неходовые цоколя ламп и температуры (например лампа 9005 устанавливается на дальний свет на некоторые автомобили производства США и Японии). Зачем держать в наличии 50 комплектов которые мы не продадим даже за год? Кроме того оф представители ставят свой гарантийный стикер с датой (Вы хотите купить комплект ксенона гарантийный стикер на котором полугодичной давности?)
    3 — когда установили ксенон-1-ну фару забыли закрутить вовсе. Я думаю что любой человек которому не прикрутили бы фару он обязательно перезвонил (хотя бы из за того что болты остались в таком случае на СТО). Мне никто не звонил (я готов предоставить распечатку звонко моего телефона)… но нам надо знать номер нашего тайного клиента (а это я думаю не реально).
    4 — блоки розжига не прикрутили,положили сбоку фары. У каждого клиента мы уточняем как крепить блоки (сверлить или на стяжки, прятать или оставлять в доступном месте).
    5 — везде торчат какие-то скрутки обмотанные изо-лентой – изо ленты там не может быть (потому что она там просто ненужна). Все устанавливается на разъемах без надрезов и скручивания (KET и AMP). Каждая лампа имеет герметичную заглушку для вывода проводов через крышку в фаре.
    6 – по поводу гарантии. Все гарантийніе вопросі решаются в основном в день обращения. Есть случаи когда ни у нас ни у оф представителя нету блока или лампы (тогда мы временно меняем на другой), это бывает крайне редко.
    7 – по поводу малолеток. Возраст сотрудников 22г., 24г., 25л., 29., 30лет., а МИНИМАЛЬНЫЙ опыт роботы в этой сфере 3 ГОДА. Минимальный опып установки линз у мастера которому 22года (он установил биксеноновые линзы на 26 автомобилей)….о установке ксенона я вообще молчу.
    Если бы все было плохо били б у нас сотни постоянных клиентов на полировку химчистку, исть клиент который установил у нас парктроник на свое авто и посоветовал прислал к нам еще 5 своих знакомых, другой клиент устанолвил у нас парктроник на все автомобили в семье (5 штук)., есть клиент который у нас полирует автомобили с фирмы (каждый год по 3-5 машин), один из последний случаев (на 1.03.2013) клиент установил у нас быксеноновые линзы, через три дня установил еще линзы в дальний свет и ксенон в противотуманные фары, а через неделю приехал с другом также на установку двух комплектов биксеноновых линз и ксенона в ПТФ (автомобили Toyota Sequoia и Toyota LC200 комплектация без линз). Еще один клиент Subaru Forester сделал у нас: шумоизоляцию, полировку, химчистку, установил парктроник, биксеноновые линзы, ксенон в ПТФ, ходовые огни, ксенон в задний ход. Вопрос … если все так плохо, неужели эти люди не ценят себя своих близких и свои автомобили что бы приезжать к нам снова и снова и советовать нас своим родственникам, друзьям, коллегам, знакомым?
    Если у кого-то из Вас (прочитавших эти отзывы) есть сомнения, позвоните нам и скажите что Вас все устраивает но есть сомнения из-за этих отзывов и мы вместе найдем компромисс (либо скидка или какая-то тестовая работа или подъезжайте посмотрите на выполнение работ на других автомобилях).

  • Рейтинг: 2.5 из 5 22.02.2012 Александр на ford
    Время визита: 2 февраля

    На дверях машины началась коррозия, внизу. Поехал в автосервис, на покраску, ездил в Qмоторс, устранили коррозию, покрасили. Вообщем все хорошо.

  • Quality Motors: отзывы сотрудников о работодателе

    А

    Абакан

    Абу-Даби

    Агидель

    Агрыз

    Адлер

    Азов

    Аксай

    Актобе

    Алапаевск

    Алатырь

    Алейск

    Александров

    Алексеевка (Белгородская область)

    Алексин

    Алматы

    Алупка

    Алушта

    Альметьевск

    Амстердам

    Анапа

    Ангарск

    Анталья

    Апатиты

    Апрелевка

    Аргаяш

    Арзамас

    Армавир

    Арсеньев

    Артём

    Архангельск

    Асбест

    Асино

    Астрахань

    Атырау

    Ачинск

    Ашхабад

    Б

    Байконур

    Баку

    Балаково

    Балахна

    Балашиха

    Балашов

    Бали

    Бангкок

    Барнаул

    Барыш

    Батайск

    Бахмут

    Бахчисарай

    Бежецк

    Белгород

    Белебей

    Белогорск

    Белорецк

    Белореченск

    Белоярский

    Бердск

    Березники

    Берёзовский

    Берлин

    Берн

    Бийск

    Биробиджан

    Бирск

    Бишкек

    Благовещенка

    Благовещенск

    Благодарный

    Бобруйск

    Богородск

    Боготол

    Бодайбо

    Бологое

    Болхов

    Бор

    Борисоглебск

    Боровск

    Братск

    Брест

    Бронницы

    Брянск

    Бугульма

    Бугуруслан

    Будапешт

    Буденновск

    Бузулук

    Бургас

    Бутурлиновка

    Буффало

    Бухара

    В

    Варна

    Варшава

    Вахруши

    Великие Луки

    Великий Новгород

    Великий Устюг

    Верхнеуральск

    Верхний Тагил

    Верхний Уфалей

    Верхняя Пышма

    Верхняя Салда

    Веспрем

    Видное

    Вильнюс

    Вилючинск

    Винница

    Витебск

    Вичуга

    Владивосток

    Владикавказ

    Владимир

    Волгоград

    Волгодонск

    Волгореченск

    Волжск

    Волжский

    Вологда

    Володарск

    Волоколамск

    Волхов

    Вольск

    Воркута

    Воронеж

    Ворсма

    Воскресенск

    Воткинск

    Всеволожск

    Выборг

    Выкса

    Вытегра

    Вышний Волочек

    Вяземский

    Вязники

    Вязьма

    Вятские Поляны

    Г

    Гагарин

    Гамбург

    Гатчина

    Геленджик

    Георгиевск

    Гётеборг

    Глазов

    Гомель

    Горки Ленинские

    Горно-Алтайск

    Городец

    Гороховец

    Горячий Ключ

    Грайворон

    Гродно

    Грозный

    Грязи

    Губкин

    Губкинский

    Гуково

    Гулькевичи

    Гусев

    Гусь-Хрустальный

    Гянджа

    Д

    Дальнереченск

    Данков

    Дедовск

    Дербент

    Десногорск

    Дзержинск

    Димитровград

    Дмитров

    Днепр (Днепропетровск)

    Долгопрудный

    Домодедово

    Донецк

    Донской

    Дубна

    Дудинка

    Душанбе

    Дюртюли

    Е

    Евпатория

    Егорьевск

    Ейск

    Екатеринбург

    Елабуга

    Елец

    Еманжелинск

    Енакиево

    Ереван

    Ессентуки

    Ефремов

    Ж

    Железногорск

    Железнодорожный

    Жигулевск

    Житомир

    Жодино

    Жуковский

    З

    Забайкальск

    Заволжье

    Закаменск

    Заозерск

    Западная Двина

    Заполярный

    Запорожье

    Зарайск

    Заречный

    Звенигород

    Зеленоград

    Зеленодольск

    Зеленокумск

    Златоуст

    Знаменск

    Зубова Поляна

    И

    Ивангород

    Ивано-Франковск

    Иваново

    Ивантеевка

    Ижевск

    Иланский

    Инза

    Иннополис

    Инта

    Иркутск

    Исилькуль

    Искитим

    Истра

    Ишим

    Ишимбай

    Й

    Йошкар-Ола

    К

    Кавалерово (Посёлок городского типа)

    Казань

    Калачинск

    Калининград

    Калиновка

    Калтан

    Калуга

    Каменск-Уральский

    Каменск-Шахтинский

    Каменское

    Камень-на-Оби

    Камышин

    Кандалакша

    Канск

    Караганда

    Карпинск

    Карши

    Касимов

    Каспийск

    Качканар

    Кашира

    Кемерово

    Керчь

    Киев

    Кимры

    Кингисепп

    Кинель-Черкассы

    Кинешма

    Кириши

    Киров

    Кировск (Ленинградская область)

    Киселёвск

    Кисловодск

    Кишинев

    Клайпеда

    Климовск

    Клин

    Клинцы

    Кобрин

    Ковров

    Ковылкино

    Когалым

    Коломна

    Колпино

    Кольчугино

    Коммунар

    Комсомольск-на-Амуре

    Конаково

    Кондопога

    Кондрово

    Константиновск

    Копейск

    Кореновск

    Коркино

    Королёв

    Коряжма

    Костомукша

    Кострома

    Котельники

    Котлас

    Краков

    Краматорск

    Краслава

    Красногорск

    Краснодар

    Красное Село

    Краснозаводск

    Краснослободск

    Красноуральск

    Красноуфимск

    Красноярск

    Красный Бор

    Красный Сулин

    Кривой Рог

    Кропивницкий

    Кропоткин

    Крымск

    Кстово

    Кубинка

    Кудымкар

    Кузнецк

    Кулебаки

    Кумертау

    Курган

    Курганинск

    Курск

    Кушва

    Кызыл

    Кыштым

    Кяхта

    Л

    Лабинск

    Лангепас

    Лениногорск

    Ленинск-Кузнецкий

    Ленск

    Лепель

    Лермонтов

    Лесной

    Ливорно

    Ликино-Дулёво

    Лимасол

    Липецк

    Лиски

    Лихославль

    Лобня

    Лодейное Поле

    Лондон

    Лосино-Петровский

    Луга

    Луганск

    Луховицы

    Лыткарино

    Львов

    Любек

    Люберцы

    Любляна

    Людиново

    Лянтор

    М

    Магадан

    Магнитогорск

    Майкоп

    Малаховка

    Малоярославец

    Мамадыш

    Мариинск

    Мариуполь

    Маркс

    Махачкала

    Мегион

    Межвежьегорск

    Междуреченск

    Мелитополь

    Мерсин

    Миасс

    Миллерово

    Минеральные Воды

    Минск

    Минусинск

    Мирный

    Михайловка

    Мичуринск

    Могилёв

    Мозырь

    Молодечно

    Монино

    Монреаль

    Москва

    Московская Область

    Муезерский

    Муравленко

    Мурманск

    Муром

    Мытищи

    Мюнхен

    Н

    Набережные Челны

    Навашино

    Надым

    Назарово

    Нальчик

    Наро-Фоминск

    Нахабино

    Находка

    Невельск

    Невинномысск

    Немиров

    Нерюнгри

    Нефтекамск

    Нефтекумск

    Нефтеюганск

    Нижневартовск

    Нижнекамск

    Нижний Новгород

    Нижний Тагил

    Николаев

    Никосия

    Новоалександровск

    Нововоронеж

    Новокузнецк

    Новокуйбышевск

    Новомичуринск

    Новомосковск

    Новополоцк

    Новороссийск

    Новосибирск

    Новотроицк

    Новочебоксарск

    Новочеркасск

    Новый Оскол

    Новый Уренгой

    Ногинск

    Норильск

    Ноябрьск

    Нур-Султан

    Нурлат

    Нью-Йорк

    Нюрнберг

    Нягань

    Нязепетровск

    О

    Обнинск

    Обухово

    Одесса

    Одинцово

    Озёрный

    Озерск

    Октябрьский

    Омск

    Онега

    Опочка

    Орел

    Оренбург

    Орехово-Зуево

    Орск

    Орша

    Островец

    Отрадный

    Оха

    П

    Павлово

    Павловск

    Павловский Посад

    Певек

    Пенза

    Первоуральск

    Переславль-Залесский

    Пермь

    Петрозаводск

    Петропавловск

    Петропавловск-Камчатский

    Печора

    Печоры

    Питкяранта

    Пласт

    Подольск

    Подпорожье

    Покачи

    Покров

    Полысаево

    Полярный

    Поронайск

    Посёлок Афипский

    Посёлок Ахтырский

    Поселок Грибановка

    Поселок Запрудня

    Поселок Любучаны

    Поселок Правдинский (Пушкинский район)

    Поселок Раевский

    Поселок Сабетта

    Поселок Таксимо

    Похвистнево

    Приозерск

    Прокопьевск

    Промышленная (Посёлок городского типа)

    Протвино

    Прохладный

    Псков

    Пугачев

    Пушкин

    Пушкино

    Пущино

    Пыть-Ях

    Пятигорск

    Р

    Райчихинск

    Раменское

    Рассказово

    Ревда

    Реутов

    Речица

    Ржев

    Рига

    Родники

    Родос

    Рославль

    Россошь

    Ростов-на-Дону

    Ртищево

    Рубцовск

    Рудный

    Руза

    Рыбинск

    Рыбница

    Рязань

    С

    Салават

    Салехард

    Сальск

    Самара

    Самарканд

    Санкт-Петербург

    Саранск

    Сарапул

    Саратов

    Саров

    Саяногорск

    Светловодск

    Светлогорск

    Светлоград

    Свободный

    Севастополь

    Северобайкальск

    Северодвинск

    Северодонецк

    Североуральск

    Северск

    Сегежа

    Село Дубовское (Ростовская область)

    Село Кожевниково (Томская область)

    Село Шипуново

    Селятино

    Семёнов

    Серафимович

    Сергач

    Сергиев Посад

    Серов

    Серпухов

    Сибай

    Симферополь

    Скопин

    Славгород

    Славянск-на-Кубани

    Сланцы

    Слуцк

    Смоленск

    Сморгонь

    Снежинск

    Советск

    Советская Гавань

    Соликамск

    Солнечногорск

    Сосновый Бор

    Сочи

    Среднеуральск

    Ставрополь

    Станица Брюховецкая

    Станица Гиагинская

    Станица Динская

    Станица Ильская

    Станица Ленинградская

    Станица Северская

    Станица Холмская

    Староминская

    Старый Оскол

    Стерлитамак

    Стокгольм

    Стрежевой

    Струнино

    Ступино

    Суджа

    Суздаль

    Сумы

    Сургут

    Сызрань

    Сыктывкар

    Сысерть

    Т

    Таганрог

    Талдом

    Таллин

    Тамань

    Тамбов

    Ташкент

    Таштагол

    Тбилиси

    Тверь

    Темрюк

    Тикси

    Тимашевск

    Тирасполь

    Тихвин

    Тихорецк

    Тобольск

    Тольятти

    Томилино

    Томск

    Топки

    Торонто

    Тосно

    Тотьма

    Троицк

    Туапсе

    Туймазы

    Тула

    Тучково

    Тында

    Тюмень

    У

    Ува (поселок)

    Удомля

    Узловая

    Улан-Удэ

    Ульяновск

    Урай

    Уральск

    Уренгой

    Урюпинск

    Усинск

    Уссурийск

    Усть-Илимск

    Усть-Кут

    Усть-Лабинск

    Уфа

    Ухта

    Учалы

    Ф

    Фалькензе

    Фано

    Феодосия

    Фрязино

    Фряново

    Фурманов

    Х

    Хабаровск

    Ханты-Мансийск

    Харцызск

    Харьков

    Хасавюрт

    Хельсинки

    Херсон

    Химки

    Хмельницкий

    Хотьково

    Ц

    Цюрих

    Ч

    Чайковский

    Чапаевск

    Чебоксары

    Челябинск

    Череповец

    Черкассы

    Черкесск

    Чернигов

    Черновцы

    Черноголовка

    Черногорск

    Чернушка

    Чехов

    Чистополь

    Чита

    Чкаловск

    Чугуев

    Ш

    Шадринск

    Шанхай

    Шарыпово

    Шатура

    Шахты

    Шексна

    Шимановск

    Шимкент

    Шлиссельбург

    Шпангенберг

    Шумерля

    Шуя

    Шяуляй

    Щ

    Щекино

    Щелково

    Щербинка

    Э

    Электросталь

    Электроугли

    Элиста

    Энгельс

    Ю

    Югорск

    Югра

    Южно-Сахалинск

    Южноуральск

    Юрга

    Юрьевец

    Я

    Якутск

    Ялта

    Ялуторовск

    Янаул

    Ярославль

    Ярцево

    Ясногорск

    Яхрома

    Кволити Моторс: Москва, Севастопольский просп., 95Б

    Адрес: Москва, Севастопольский просп., 95Б
    Дополнительные контакты:

    www.qmotors.ru/

    Координаты (ш/д): 55.6353, 37.5436
    Телефон: +7 (499) 288-20-54 Время работы: ежедневно, 09:00–21:00
    Бесплатный Wi-Fi
    Показать все заведения сети Кволити Моторс в Москве.

    Внимание! В связи с эпидемией COVID-19 режим работы заведения может быть изменен. Мы рекомендуем уточнять необходимую информацию по телефону.

    Описание организации:

    Wi-Fi, антикор, базовое сервисное обслуживание, дизельный автосервис, кузовной ремонт, мойка, оплата банковской картой, предварительная запись, развал-схождение, удаление вмятин без покраски, шиномонтаж

    виды работ: замена масла, заправка и ремонт автокондиционера, компьютерная диагностика автомобиля, покраска автомобиля, полировка, полное сервисное обслуживание, промывка инжектора, ремонт автоэлектрики, ремонт автоэлектроники, ремонт акпп, ремонт генераторов, ремонт глушителей, ремонт двигателя, ремонт карданных валов, ремонт кпп, ремонт пластиковых бамперов, ремонт рулевых реек, ремонт стартеров, ремонт топливной системы, ремонт тормозной системы, ремонт форсунок, ремонт ходовой части, сигнализация, тонировка стекол, установка парктроника, чистка форсунок

    марка: acura, alfa romeo, audi, bmw, buick, cadillac, chevrolet, chrysler, citroen, daewoo, daihatsu, datsun, dodge, fiat, ford, gmc, honda, hummer, hyundai, infiniti, isuzu, iveco, jaguar, jeep, jmc, kia, land rover, lexus, lincoln, mazda, mercedes-benz, mini, mitsubishi, nissan, oldsmobile, opel, peugeot, plymouth, pontiac, porsche, renault, rover, seat, škoda, smart, ssangyong, subaru, suzuki, toyota, volkswagen, volvo, европейские, импортные, корейские, легковые, японские

    Кволити Моторс относится к рубрикам: автосервисы, кузовной ремонт, ремонт двигателей. Во избежание возможных недоразумений старайтесь уточнять информацию по телефону организации: +7 (499) 288-20-54. далее >>>У этой фирмы пока нет рейтинга. Вы тоже можете повлиять на рейтинг этого заведения, нажав на ⭐️⭐️⭐️⭐️⭐️ наверху справа. Таким образом вы посоветуете пользователям посетить или нет Кволити Моторс. А еще лучше, если вы напишете подробный отзыв 💬 на Кволити Моторс — нашим посетителям будет полезно узнать ваше объективное, или не очень, мнение. скрыть <<<

    Ближайшие организации в рубриках «автосервисы, кузовной ремонт, ремонт двигателей» в Москве

    Рубрики: Автосервисы, Кузовной ремонт, Ремонт двигателей Рубрики: Автосервисы, Автостекла, Кузовной ремонт Рубрики: Автосервисы, Шиномонтаж Рубрики: Автосервисы, Шиномонтаж Рубрики: Автосервисы, Шиномонтаж Рубрики: Автосервисы

    Оператор техосмотра №08028 ООО «Кволити Моторс» (ИНН 7706426675, ОГРН 1157746857289)

    Статус
    Аттестат действителен

    Краткое наименование
    ООО «Кволити Моторс»

    Полное наименование
    Общество с ограниченной ответственностью «Кволити Моторс»

    Директор
    Вережников Алексей Геннадьевич

    ИНН
    7706426675

    ОГРН / ОГРНИП
    1157746857289

    Юридический адрес организации
    127644 Москва г., Москва г., Лобненская ул., д.17., кв.оф.21, эт.1

    E-mail
    [email protected]

    Кволити Моторс отзывы об автосервисе

    Краткая предыстория: мою почти новую машину облили с соседней стройки каплями цемента. На мойке цемент с кузова почти полностью отмылся (с помощью химии за 3 подхода), а вот к стёклам цемент как будто приварился. В итоге, после отмывки, оказалось, что цемент (как абразив) сильно поцарапал заднее и боковые стёкла, несколько царапин были довольно глубокие.

    Стал искать и обзванивать сервисы в Мск, которые занимаются устранением глубоких царапин на автостёклах (как оказалось, полируют стёкла многие, а вот шлифуют, для устранения глубоких царапин – нет).
    Среди тех, кто готов был устранить мою проблему за адекватные деньги (исходя из общения по телефону), оказался сервис Quality Motors (на Севастопольском проспекте). После визита в этот и в ещё один сервис и консультаций мастера, выбрал Кволити моторс (больше доверия вызвал). Договорился об условиях и сроках ремонта (пригнал авто утром, забрал на следующий день) – в итоге все договоренности были соблюдены, результатом доволен.
    Спасибо Юрию, Антону и Дмитрию за проведенную в срок качественную работу – даже от самых глубоких царапин не осталось и следа!

    Плюсы:
    +ответственные, профессиональные и дружелюбные мастера
    +внимание к клиентам и переживание за результат работы
    +отличная клиентская зона с диванчиками и LCD ТВ
    +светлая и чистая рабочая сервисная зона
    +возможность находиться в сервисной зоне (при желании)
    +сделали то, что обещали, и даже больше(!)
    +оплата картой
    +интересная бонусная программа
    +бесплатная мойка перед выдачей авто (и снаружи, и в салоне)

    Минусы:
    -ожидание (подъезжал чётко к оговоренному времени на сдачу и приём авто – приходилось немного подождать). Но, учитывая удобство клиентской зоны и позитивное общение с сотрудниками, ожидание было совсем не утомительным.
    Был один косячок в работе, но вопрос сразу же решили в моих интересах, поэтому его не отношу к минусам и не учитываю в оценке.

    Однозначно рекомендую к посещению данный сервис (и сам ещё обязательно обращусь при необходимости) – успехов вам и процветания!

    ☎ QMotors.com.ua , Березняківська, 29Б, , +38 (044) 361-29-78, +38 (094) 925-99-78

    Данные об организации QMotors.com.ua, расположенной по адресу Березняківська, 29Б, Киев: контакты, почтовый адрес, описание организации, отзывы, телефоны, маршрут для проезда, карта, официальный сайт, профили в соцсетях Facebook, Instagram, Vkontakte и т.д.

    QMotors.com.ua, СТО

    Адрес:
    Березняківська, 29Б, Киев, Киев 02098
    Проложить маршрут

    Телефон:
    +38 (044) 361-29-78, +38 (094) 925-99-78

    Категории:
    Автотовары   Автосервис   Авторемонт и техобслуживание (СТО)   Кузовной ремонт   Тюнинг  

    Внести исправления

    Отзывы

    На данный момент пользователи нашего сайта не оставили отзывов об организации QMotors.com.ua. Будьте первым, кто добавит отзыв!

    Добавить отзыв

    Дополнительная информация

    QMotors.com.ua, СТО находится в городе Киев. Полный адрес: Березняківська, 29Б. Почтовый код: 02098. Уточнить детали и задать интересующие вас вопросы вы можете по телефону +38 (044) 361-29-78, +38 (094) 925-99-78 или по электронной почте . Рекомендуем вам ознакомиться с профилями компании в социальных сетях: фейсбук, инстаграм , вконтакте .

    Если вы являетесь сотрудником или владельцем этой организации и хотите изменить информацию на нашем сайте — просто нажмите на ссылку «Исправить ошибки» и заполните форму исправления данных!

    Компании, расположенные рядом

    • Маршала Тимошенка, 19, Киев, 04212

    • 0800300102, +38 (093) 550-11-11, +38 (096) 550-11-11, +38 (066) 550-11-11

      Ревуцького, 18а, Киев, 02068

    • 0800210292, +38 (073) 505-57-57

      Лесі Українки бульвар, 26/2, Киев, 01133

    • Юрія Іллєнка, 5а/1, Киев, 04050

    • Народного Ополчення, 1, Киев, 03151

    • 0800300102, +38 (093) 550-11-11, +38 (096) 550-11-11, +38 (066) 550-11-11

      Регенераторна, 4а, Киев, 02160

    Досье заказчика «Q-motors» — Advego.com

    Тип текста: ЛюбойКопирайтингРерайтинг без источникаПеревод

    Язык: ЛюбойRussian — РусскийEnglishGermany — DeutschSpanish — EspañolFrench — FrançaisChinese — 中国Ukrainian — УкраїнськаJapanese — 日本のPortuguese — PortuguêsPolish — PolskiItalian — ItalianoTurkish — TürkArabic — العربيةVietnamese — tiếng ViệtKorean — 한국의Urdu — اردوPersian — فارسیHindi — हिन्दीDutch — HollandskFinnish — suomalainenAnother language — другой язык

    Тематика: ЛюбаяБез тематикиIT, софтАвиация, военная техника, ГОАвто, мотоАзартные игры, казино, покерБытовая техникаДизайн и предметы интерьераДомашние животныеДомашние растения, цветы, растительный мирЗакон и ПравоИгрушки, товары для детейИнтернет-маркетинг, SEO, SMM, создание сайтовИстория, религия, традиции и обрядыКиноКомпьютерные игры, видеоигры и приставкиКрасота и здоровье, питание, диеты, фитнесКулинарияКультура и искусствоЛандшафтный дизайн и архитектураМатериалы 18+Мебель и аксессуарыМедицина, лечение и профилактика болезнейМобильные игры и приложенияМода и СтильМузыкаНаука, открытия, высокие технологииНедвижимостьНепознанное: фэн-шуй, астрология, гороскопыОбразование, учеба, тренингиОтдых, активные игры, охота и рыбалкаОтношения, знакомства, личная жизньПолиграфия, рекламная продукция, маркетингПолитика: аналитика и обзорыПраздники и торжества, свадьбаПрирода и экологияПромышленность и оборудованиеПсихологияРабота и карьера, фрилансРемонт и обустройствоРукоделие, хобби, handmadeСад и огород, сельское хозяйствоСемья, воспитание детей, беременность и родыСобственный бизнес, ForexСпорт и спортивный инвентарь, велотехникаСтихи и поздравленияСтроительный инструмент и материалы, садовая техникаСтроительство домов, дачное хозяйствоТуризм, достопримечательностиУслуги и сервисФинансы, банки и кредиты, экономикаФототехника, искусство фотографииЭлектроника: гаджеты, мобильные телефоны, компьютеры, телевизорыЮмор

    Отзывы о

    Q Motors — www.q-motors.com | Автосалоны

    Используйте инструменты ниже, чтобы уточнить поиск, отображая только обзоры с определенным количеством звездочек или только обзоры за определенный период времени. Например, нажмите «1 звездочка», чтобы отобразить только те обзоры, которые получили рейтинг в 1 звезду, или «В течение последнего месяца», чтобы отобразить только обзоры, опубликованные за последний месяц.

    • 5 звезд
    • 4 звезды
    • 3 звезды
    • 2 звезды
    • 1 звезда 2
    • В течение последнего месяца (Из 0 отзывов)
    • В течение последних 6 месяцев (Из 0 отзывов)
    • В течение последних 12 месяцев (Из 0 отзывов)

    Найдите подержанные автомобили на продажу по всей Новой Зеландии от Q Motors

    Q Motors (LMVD: M212315) — специалист по импорту автомобилей Euros и Performance.Расчетное время 2010 г. Наши новые импортные товары проходят профессиональное обслуживание и уход перед продажей. Мы предлагаем лучшую цену на гарантию Autosure & Provident, доставку по всей стране.
    *** АДРЕС: Q Motors, Building 26, 7-21 Cain Road, Penrose, Auckland по предварительной записи (за 30 минут, пожалуйста).
    *** Trade-ins, простое финансовое приложение и общенациональная доставка
    *** ORC в размере 300 долларов США. распространяется на свежий импорт, мы оформляем лицензию на автомобиль и табличку, чтобы вы могли уехать через 15 минут
    *** Гарантия Autosure & Provident на механическую технику с аварийно-спасательной службой AA на 1 ~ 4 года для дополнительного спокойствия по конкурентоспособной цене
    Характеристики
    — BMW 335i LCI Facelift Motorsport Coupe 2011 года в синем цвете с сертифицированным пробегом 69,430 км.Собирается вручную из Японии, обслуживается и ухожен по прибытии. Аукционная оценка 4.5
    — Двигатель только что отремонтирован по прибытии
    — Полная история обслуживания от BMW Japan (9 км, 12, 108 км, 26, 027 км, 30, 516 км, 46, 285 км, 47, 250 км, 56, 091 км, 62, 883 км)
    — Радиокодирование с частотой NZ
    — Спутниковая навигация NZ
    — Двигатель N55 Twin-scroll с турбонаддувом и прямым впрыском
    — Коробка передач с двойным сцеплением и спортивной кнопкой
    — Пакет LCI, включающий CIC I-Drive, обновленный ЭБУ и программное обеспечение, обновленные фары и задние фонари и т. д.
    — Электрические зеркала, электрические стеклоподъемники, электрические сиденья
    — Динамический контроль устойчивости, антипробуксовочная система
    — Несколько подушек безопасности
    — Заводская сигнализация и иммобилайзер
    — Кожаные сиденья с подогревом и функцией памяти
    — Система комфортного доступа
    — Динамический контроль устойчивости
    — Активный рулевое управление
    — Регенерация энергии торможения
    — Адаптивная фара
    — Ксеноновая фара
    — Парковочная дистанция
    — Круиз-контроль
    — Подрулевой переключатель
    — 18 Заводские сплавы Msport 90 043 — Пакет факторов Msport, включая подвеску Msport, пакет Msport Aerodynamic, рулевое колесо M, сиденья Msport и т. Д.
    — 2 Заводские дистанционные ключи

    qMotor, набор правил для чувствительных, надежных и количественных измерений двигательных функций у мышей

    Abstract

    Фенотипический анализ моделей болезней человека на мышах необходим для понимания основных механизмов заболевания и разработки терапевтических средств.Многие модели нейродегенеративных заболеваний связаны с двигательной дисфункцией, что является мощным индикатором болезни. Мы описываем здесь набор мер по количественному мониторингу раннего начала и прогрессирования заболевания с помощью вращательного анализа. Мы назвали этот набор правил qMotor, потому что он позволяет проводить точные, надежные и количественные измерения двигательной активности. Результат можно получить через три дня. qMotor можно использовать для оценки раннего начала заболевания, до паралича, а также прогрессирования заболевания на различных моделях мышей, и его можно использовать для определения надежных и гуманных экспериментальных конечных точек, тем самым уменьшая страдания животных.В качестве примера приложения мы применяем qMotor к трансгенным мышам SOD1 G93A . Ранние исследования исходных трансгенных мышей SOD1 G93A на гибридном фоне (B6SJL-Tg (SOD1-G93A) подвергались критике из-за высокого шума на этом смешанном фоне и неадекватного дизайна исследования. Мы применили qMotor на трансгенных мышах SOD1 G93A в инбредном фоне C57BL / 6J, в дальнейшем называемом iSOD1 G93A , и демонстрируют удивительно устойчивый и последовательный фенотип в этой линии, который можно использовать для оценки терапевтических подходов.qMotor — это протокол, обычно применимый к различным моделям мышей.

    Введение

    Нейродегенеративные заболевания разрушительны и затрагивают все большее число людей в нашем стареющем обществе. Созданы мышиные модели, воспроизводящие ключевые особенности нейродегенеративных заболеваний человека, которые представляют ценность для изучения механизмов болезни и потенциальных терапевтических средств. 1 . Поскольку никакие методы лечения еще не были переведены на людей, чтобы остановить или замедлить прогрессирование этих все более распространенных нейродегенеративных заболеваний, мышиные модели подверглись критике 1 .Однако эти мышиные модели развивают репрезентативные черты болезней человека, и плохая переводимость доклинических исследований вполне может быть результатом неадекватного дизайна исследований, а не недостатков самой модели 1 .

    Обоснование протокола

    Многие модели нейродегенеративных заболеваний связаны с двигательной дисфункцией. Таким образом, оценка двигательного дефицита представляет собой мощный инструмент для оценки потенциальных терапевтических методов лечения на различных моделях заболеваний.

    Меры, часто используемые для выявления фенотипа заболевания у трансгенных мышей SOD1, такие как потеря веса или анализ походки, выявляют изменения на поздней стадии 2 , 3 . Таким образом, в подавляющем большинстве исследований, проведенных на сегодняшний день, использовались протоколы с тяжелыми экспериментальными конечными точками (паралич или смерть) для оценки начала и прогрессирования заболевания у мышей SOD1 4 . В этом протоколе мы описываем, как реализовать qMotor, простой набор мер и правил, который позволяет количественно и надежно оценивать двигательные характеристики трансгенных мышей, тем самым облегчая изучение нейродегенеративных заболеваний и оценку потенциальных терапевтических подходов.Сначала мы использовали qMotor для оценки терапевтической эффективности терапевтического подхода 3 .

    qMotor является значительным улучшением по сравнению с альтернативными методами. Во многих исследованиях используются такие показатели, как потеря веса, анализ походки, паралич или смерть, выявляются изменения на поздней стадии и требуется большее количество животных 2 , 3 . qMotor можно широко использовать для выявления начала заболевания до тяжелого паралича и для проведения надежных исследований с гуманными, но надежными конечными точками, тем самым уменьшая страдания и количество животных, в соответствии с принципом 3Rs

    Различение обучения навыкам и двигательной активности с помощью анализа вращающегося стержня

    qMotor использует тест вращающегося стержня для оценки характеристик двигателя.В тесте с вращающимся стержнем мышей обучаются бегать по горизонтально вращающемуся стержню, а время ожидания падения используется как мера двигательных способностей. Анализ Rotarod можно использовать для двух целей: для изучения навыков 5 и для оценки двигательной активности 6 . Известно, что производительность увеличивается с течением времени во время нескольких занятий с вращающимся стержнем по мере развития тренировок и выходит на плато после нескольких занятий. 5 . Это результат обучения двигательным навыкам и не отражает пригодность 5 .Известно, что улучшение между сеансами уменьшается с количеством сеансов 5 . После начального периода обучения анализатор вращающегося стержня измеряет характеристики двигателя 5 . Таким образом, важно избегать смешивающего эффекта фазы моторного обучения, чтобы дать возможность количественной оценки моторных характеристик с помощью анализа вращающегося стержня.

    Оценка моторного дефицита с помощью анализов ротарода

    Ранее мы использовали анализ ротарода, чтобы продемонстрировать терапевтическую эффективность селективного ингибитора фосфатазы Sephin1 в двух независимых моделях мышей 3 , используя усовершенствованную процедуру ротарода, которую мы сейчас описываем здесь.Мы обнаружили, что Sephin1 предотвращает моторные и молекулярные дефекты в модели трансгенных мышей демиелинизирующей нейропатии Charcot-Marie-Tooth 1B (CMT-1B) 3 . Модель CMT-1B, впервые опубликованная в 2006 г. 7 , представляет собой надежную модель CMT-1B на фоне FVB / N и использовалась в многочисленных исследованиях. Делеция серина 63 в миелиновом белке (P0S63del), одном из наиболее распространенных белков, вырабатываемых шванновскими клетками в периферической нервной системе, вызывает демиелинизирующую нейропатию CMT-1B у людей за счет усиления токсических свойств из-за неправильной укладки мутанта. белок 7 .Трансгенные мыши, экспрессирующие мутантный трансген P0S63del, воспроизводят ключевые особенности болезни человека 7 . У мышей CMT-1B развиваются двигательные дефициты из-за дефектов миелинизации как следствие неправильной укладки миелина P zero 7 . В то время как мыши CMT-1B не проявляют явного клинического фенотипа, повторные анализы ротарод в возрасте 4 месяцев с 14 мышами CMT-1B и 14 однопометниками дикого типа выявили устойчивый дефицит у мышей CMT-1B 3 , 7 9 .

    Мы также ранее сообщали, что Sephin1 предотвращает моторные и молекулярные дефекты модели мыши SOD1 G93A ALS. В этом исследовании мы обнаружили устойчивые фенотипы с помощью ротародного анализа с 4 или 6 животными в группе 7 , тогда как предыдущие руководящие принципы рекомендовали использовать когорту из 24 животных в группе для оценки фенотипа у трансгенных мышей SOD1 10 . Наше предыдущее исследование 3 продемонстрировало, что анализ вращающихся стержней чувствителен и позволяет обнаруживать моторный фенотип на ранней стадии заболевания, до появления видимых моторных дефектов у небольшого количества животных.Ниже мы описываем линию мышей, выбранную для этих исследований, и подробный протокол qMotor, который мы установили для получения этих результатов 3 . Этот протокол можно использовать с различными линиями мышей для получения надежных результатов с уменьшенным количеством животных.

    Выбор линии мышей

    Для разработки процедуры мы рекомендуем тестировать трансгенных мышей с моторным дефицитом разной степени тяжести вместе с их однопометниками дикого типа по возрасту. Среди разнообразных моделей нейродегенеративных заболеваний модель трансгенных мышей SOD1 G93A особенно привлекательна, поскольку она точно воспроизводит многие определяющие особенности бокового амиотрофического склероза (БАС): неправильное сворачивание белка, вызывающего заболевание, двигательные дефекты из-за потери двигательных нейронов и т. Д. паралич задних конечностей и нейровоспаление 11 , 12 .

    Исходный штамм SOD1 G93A поддерживается путем скрещивания трансгенных гемизиготных самцов с самками гибридов C57BL6SJL / J. Эта модель подверглась широкой критике, потому что исследования, проведенные в этой модели, пока не были переведены на людей 10 , 13 . Однако, поскольку БАС по-прежнему представляет собой неудовлетворенную медицинскую потребность, а модели на мышах воспроизводят ключевые особенности заболевания человека, кажется неразумным игнорировать потенциальную полезность этой модели.

    Методологические ограничения исследований, основанных на линии SOD1 G93A на смешанном фоне, были выделены ранее, и были опубликованы некоторые рекомендации по их преодолению. 10 , 13 . Однако, несмотря на то, что смешанный фон печально известен тем, что вносит большую вариабельность, важность смешанного фона как смешивающего фактора в исследованиях на животных упускается из виду, и в большинстве исследований продолжают использовать SOD1 G93A на смешанном фоне C57BL6SJL / J.Чтобы обойти эти ограничения, были получены трансгенные мыши SOD1 G93A на чистом фоне C57BL / 6J (далее называемые iSOD1 G93A ). Эта линия демонстрирует чрезвычайно устойчивое прогрессирование заболевания с очень низким фоновым шумом и замечательной стабильностью во время и между исследованиями в разных лабораториях 2 , 3 , до тех пор, пока число копий трансгена остается постоянным в колонии и в колонии. экспериментальная группа. Последнее предостережение контролируется путем анализа количества копий трансгена.

    Хотя мутации SOD1 составляют лишь часть семейных форм БАС, изучение редких форм болезни может пролить свет на механизмы или терапевтические стратегии, которые могут иметь отношение к более распространенным заболеваниям. Здесь мы предоставляем надежный протокол для мониторинга моторных дефицитов у мышей iSOD1 G93A . Этот протокол применим к различным моделям мышей.

    В модели B6SJL-Tg (SOD1-G93A) 1 предыдущие руководящие принципы рекомендовали использовать когорту из 24 животных в каждой группе (дикого типа и трансгенных) 10 .Устойчивость фенотипа в линии iSOD1 G93A означает, что количество животных, необходимое для окончательного исследования, может быть значительно сокращено. 2 . Более того, в предыдущих руководствах в качестве конечной точки использовалась смерть или крайне тяжелые фенотипы. 10 . Это должно быть пересмотрено, чтобы соответствовать Директиве Европейского Союза по исследованиям на животных (C., 2010-63-EU, статья 13.3.), В которой говорится, что «следует избегать смерти как конечной точки процедуры, насколько это возможно и заменены более ранними, гуманными конечными точками ».Это соответствует принципу 3R (замена, сокращение и уточнение) и правилам использования животных в исследованиях.

    В отличие от мышей CMT-1B, у трансгенных мышей iSOD1 G93A через 12 недель развивается паралич задних конечностей со 100% пенетрантностью 2 , 3 . Моторный фенотип трансгенных мышей iSOD1 G93A является тяжелым, что предполагает возможность надежного и количественного измерения моторных дефицитов у мышей iSOD1 G93A с помощью ротародного анализа с меньшим количеством мышей, чем требуется для количественной оценки двигательных дефектов в CMT. -1B, у которых не проявляется никаких видимых симптомов.Более того, способность обнаруживать двигательный дефицит у CMT-1B при отсутствии видимых симптомов предполагает, что у трансгенных мышей iSOD1 G93A должна быть возможность обнаруживать раннюю стадию заболевания до начала паралича, наблюдаемого на 12 неделе беременности. эта строка 3 . Обнаружение двигательного дефицита до паралича представляет собой привлекательную возможность, которая может привести к определению гуманных конечных точек, тем самым уточняя протоколы и уменьшая страдания животных.

    Обзор qMotor

    Существенные усовершенствования процедур поворотного стержня, ведущие к qMotor, состоят в увеличении продолжительности испытаний и увеличении количества испытаний.Этот протокол может быть длиннее, чем предыдущие протоколы, но дает надежные результаты с меньшим количеством животных.

    Традиционно анализы вращающегося стержня с мышами SOD1 выполняются с тремя испытаниями путем регистрации задержки падения на ускоряющий вращающийся стержень (4-40 об / мин) с продолжительностью испытания 150-180 секунд 14 . Напротив, анализ вращающихся стержней с мышами CMT-1B традиционно проводится с шестью сессиями по три испытания. Каждый сеанс длится 900 секунд: 300 секунд разгона (4-40 об / мин), затем 600 секунд при 40 об / мин 3 , 7 .Как уже отмечалось ранее 7 , мыши улучшают свои характеристики в течение первых трех сеансов по мере обучения (). После пятого сеанса улучшения плато () и 5 . Следовательно, двигательные дефициты мышей CMT-1B не наблюдаются в первые три сеанса, так как они осложняются фазой обучения, но стали очевидными после четвертого сеанса 7 (). Точно так же, если смотреть на терапевтический эффект Sephin1, он не обнаруживается в течение первых трех сеансов, но становится очевидным и устойчивым после четвертого сеанса как у самок, так и у самцов (и дополнительный рис.1). Эти примеры результатов показывают, что повторные анализы вращающихся стержней могут быть использованы для количественной оценки моторного дефицита в отсутствие видимого фенотипа, и демонстрируют, что продолжительность испытаний и количество испытаний могут иметь влияние на испытания вращающихся стержней.

    Rotarod-анализ мышей CMT-1B.

    Анализ Rotarod 4-месячных мышей дикого типа или CMT-1B указанного возраста после перорального введения через желудочный зонд Sephin1 (1 мг / кг) или носителя в течение 3 месяцев. Данные представляют собой средние значения трех испытаний, проведенных в один день с 14 мышами ± стандартная ошибка среднего.Обозначены этап обучения и проверка двигательных навыков. Никакие образцы, мыши или точки данных не были исключены из анализа. Все представленные данные были собраны в соответствии с государственными и институциональными руководящими принципами по уходу и использованию лабораторных животных. * P ≤ 0,05; ** P ≤ 0,01; *** P ≤ 0,001; **** P ≤ 0,0001; (F (1,29) = 22,8, р <0,001). Получено институциональное одобрение этой процедуры. Исходные данные в Supp Table 1.

    Зная, что мы можем количественно оценить моторный дефицит мышей CMT-1B в отсутствие видимого моторного фенотипа, мы пришли к выводу, что тесты Rotarod с мышами iSOD1 G93A могут быть улучшены за счет увеличения продолжительности испытания и количества. испытаний.Поэтому в предыдущем исследовании 3 мы протестировали мышей iSOD1 G93A и однопометников дикого типа (n = 4-6 мышей в группе), используя усовершенствованную процедуру поворотного стержня, состоящую из 3-дневного испытания, с 3 испытаниями в день 3 . Мы представляем различные испытания нашего предыдущего исследования 3 . Продолжительность каждого испытания была установлена ​​на уровне 300 секунд на основании пилотных экспериментов, показывающих, что этой продолжительности было достаточно для выявления фенотипа мышей iSOD1 G93A до начала паралича.Мы провели тесты на вращающихся стержнях с мышами iSOD1 G93A и однопометниками дикого типа в возрасте 60 дней и заметили, как ранее сообщалось 5 , что производительность улучшалась с увеличением количества сеансов (). Поскольку предыдущие исследования показали, что улучшение характеристик вращающегося стержня выходит на плато после 5-6 испытаний 5 , этот период обучения должен быть исключен из экспериментальных тестов, направленных на оценку двигательных характеристик. В типичном эксперименте после периода обучения двигательные дефекты у мышей iSOD1 G93A устойчивы и устойчивы в трех испытаниях ().Здесь мы повторно проанализировали наше ранее опубликованное исследование 3 путем разделения полов и обнаружили, что фенотип был одинаково устойчивым для обоих полов (дополнительный рис. 2). Тесты Rotarod, проведенные на отдельной когорте мышей дикого типа и мышей iSOD1 G93A в возрасте 90 дней, подтвердили, что двигательные дефициты в iSOD1 G93A повторяются как у самцов, так и у самок (дополнительный рисунок 3). Это устанавливает надежный метод количественной оценки двигательных дефектов у мышей iSOD1 G93A с небольшим количеством мышей до появления видимого паралича.

    Рабочий процесс qMotor.

    a, Мышей сначала приучают в течение 1 минуты на статическом роторе и 1 минуту при постоянной скорости (4 об / мин). Это привыкание проводится дважды, только перед первой фазой тестирования. b , Животных обучают обучению двигательным навыкам в трех испытаниях, проводимых в течение двух последовательных дней с минимум 15-минутным перерывом. c , Дрессированные животные тестируются методом вращающегося стержня, обычно три испытания в день в течение трех дней.

    Ранние двигательные нарушения и эффективность Sephin1 у мышей iSOD1 G93A .

    a , Повторный анализ на вращающемся стержне (3 испытания в день) мышей дикого типа и мышей iSOD1 G93A (возраст 60 дней). Данные представляют собой средние значения ± SEM (n = 4). b, Повторный роторный анализ мышей дикого типа или iSOD1 G93A указанного возраста (дни), получавших перорально Sephin1 (5 мг / кг) или носитель один раз в день, начиная с 28-дневного возраста. Данные представляют собой средние значения 3 испытаний, проведенных в один и тот же день с участием 4-6 мышей на группу ± стандартная ошибка среднего. Обозначены этап обучения и проверка двигательных навыков.Никакие образцы, мыши или точки данных не были исключены из анализа. Все представленные данные были собраны в соответствии с государственными и институциональными руководящими принципами по уходу и использованию лабораторных животных. * P ≤ 0,05; ** P ≤ 0,01; *** P ≤ 0,001; **** P ≤ 0,0001; (F (1,14) = 12,13, p = 0,004). Получено институциональное одобрение этой процедуры. Исходные данные в дополнительной таблице 2.

    Использование qMotor для проверки эффективности лекарств

    Эту процедуру можно использовать для оценки эффективности лекарств с течением времени.Мы демонстрируем результаты, полученные при лечении мышей iSOD1 G93A с помощью Sephin1 с течением времени, с помощью анализа вращающихся стержней (). На этом рисунке представлены различные испытания нашего предыдущего исследования 3 . Были использованы четыре экспериментальные группы, состоящие из рандомизированных мышей iSOD1 G93A и однопометников дикого типа, получавших Sephin1 (5 мг / кг, один раз в день) или носитель с 4-недельного возраста. Как отмечалось выше, первые 6 сеансов (день 1 и 2) тестов с вращающимся стержнем исключаются из анализов, направленных на измерение двигательных характеристик, из-за смешивающего эффекта фазы обучения 5 .Грызуны сохраняют навыки вращения стержня после того, как они их освоили. 5 (), поэтому нет необходимости в дополнительных периодах обучения даже после месяца отсутствия обучения. После фазы обучения в течение первых 2 дней испытаний последующие испытания во всех четырех группах были на удивление последовательными (). Это демонстрирует, что qMotor чрезвычайно надежен для измерения моторных дефектов у мышей iSOD1 G93A и дополнительно подчеркивает надежность и постоянство моторного фенотипа у мышей iSOD1 G93A .Эффективность лекарств также может быть проверена, например qMotor был использован для проверки эффективности Sephin1 iSOD1 G93A на мышах 3 . Мы наблюдали устойчивые различия между мышами iSOD1 G93A , получавшими Sephin1 или носитель, с использованием 4 или 6 мышей в каждой группе 3 . Эти различия были очень значимыми в каждый день испытания, 62-й, 90-92-й и 110-112-й дни (). Мы повторно проанализировали опубликованные нами результаты с разделением по полу и обнаружили, что аналогичные результаты были получены для обоих полов (дополнительный рис.2). Эти результаты демонстрируют, что qMotor выявляет двигательные дефициты у мышей iSOD1 G93A с очень небольшими межкогортными вариациями. Эти результаты подчеркивают надежность метода, предсказуемость двигательного дефицита у этой линии мышей, а также эффективность лечения.

    Материалы

    РЕАГЕНТЫ

    — Мыши

    • Мы используем трансгенных мышей, экспрессирующих мутантную SOD1 G93A , содержащуюся в C57BL / 6J. Можно использовать других мышей, как обсуждалось во введении.ВНИМАНИЕ! Исследователи должны соблюдать национальные правила, касающиеся животных и их использования.

    Эта процедура соответствует правилам использования животных в исследованиях (Закон о научных процедурах Великобритании 1986 года и Директива ЕС 2010/63 / EU). Институциональное одобрение для этой процедуры было получено от Лаборатории молекулярной биологии Великобритании Совета медицинских исследований в соответствии с лицензией на проект номер 70/7956 с местным этическим одобрением от комитета LMB по защите животных и этической экспертизе, а также от Отдела генетики и клеточной биологии Италии. , Научный институт Сан-Раффаэле, 20132 Милан, Италия.

    — 70% этанол и салфетки для салфеток

    — Нетоксичные красные чернила / ручка (КРИТИЧНО используйте красный цвет, потому что мыши не могут видеть этот цвет), например Pen Sharpie Permanent Marker Red (VWR, 811-0025)

    НАСТРОЙКА РЕАГЕНТОВ

    Содержание и содержание подопытных животных

    Животные должны содержаться и содержаться под присмотром в соответствии с Кодексом норм Министерства внутренних дел по содержанию и уходу за животными, используемыми в Научные процедуры.

    Мы держим мышей в вентилируемых клетках, свободных от специфических патогенов (Tecniplast GM500, Techniplast) на еловой подстилке Lignocel FS14 (IPS, Ltd.) и материал для гнезд Enviro-Dri (LBS) при 19-23 ° C с 12-часовым циклом света и темноты со светом с 7:00 до 19:00. Мы кормим наших экспериментальных животных гранулами Dietex CRM (Special Diet Services). Максимальное количество самцов, содержащихся в индивидуальной клетке, — до 4, а максимальное количество самок — до 5 соответственно. Чтобы следить за состоянием здоровья, проверяйте всех подопытных животных каждый день визуально, очищайте при загрязнении и еженедельно проводите проверку физического здоровья всех мышей. Подопытных животных еженедельно взвешивают.Подопытным животным, достигшим предела средней степени тяжести, мы предоставляем затор (гранулы Dietex CRM, смоченные в воде).

    Генерация мышей

    Мыши CMT-1B являются трансгенными в отношении мутантного нулевого миелинового белка с делецией серина 63 (P0S63del) и поддерживаются на фоне FVB / N 7 . Мы используем гемизиготных мышей CMT-1B самцов и самок и однопометников дикого типа соответствующего возраста в экспериментах. SOD1-мутантные мыши iSOD1 G93A содержатся в C57BL / 6J. Экспериментальных животных получали путем скрещивания гемизиготных самцов iSOD1 G93A с самками C57BL / 6J.Фенотип заболевания у этой линии чрезвычайно устойчив и очень похож на линию iSOD1 G93A C57BL / 6J 2 , когда число копий трансгена остается постоянным. Устойчивость и пенетрантность фенотипа позволяет быстро идентифицировать мышей с пониженным числом копий трансгена, поскольку это приводит к потере или уменьшению фенотипа. Это наблюдалось один раз с тех пор, как мы получили эту линию в 2011 году.

    Генотипирование и анализ числа копий

    Идентифицируйте мышей путем вырезания ушей и сохраняйте ушную ткань для выделения геномной ДНК с помощью набора TaqMan® Sample-to-SNP ™ (ThermoFisher Scientific , 4403081).Генотип мышей CMT-1B описан в другом месте 7 . Выполните ПЦР для генотипирования геномной ДНК в объеме 10 мкл с 500 нмоль каждого из праймеров SOD1 человека IMR002: ctaggccacagaattgaaagatct IMR0043: gtaggtggaaattctagcatcatc IMR0113: catcagccctaatccatctga IMR0114: cgatcgactaaca. После ПЦР визуализируйте продукты с помощью набора QIAxcel DNA Fast Analysis Kit (3000) Kit (Qiagen, 929008). Полоса дикого типа составляет 324 п.н., а SOD1 G93A человека — 236 п.н.

    Выполните анализ количества копий трансгена с помощью количественной ПЦР.Мы использовали 12,5 нг кДНК, SYBR ® select Master Mix (Applied Biosystems, (Ref 4472908, прикладные биосистемы) на Corbett Rotor-Gene version 6000 Warrington, UK), используя человеческий SOD1 G93A (f): gtgtgcgtgctgaagggcga, SOD1 G93A (r): ccacctttgcccaagtcatctgc, в общем объеме 12,5 мкл. Сравните значения ddCt ed с эталонным образцом кДНК, содержащим только две копии SOD1 человека.

    Разделение животных на экспериментальные группы

    В экспериментах должны использоваться трансгенные самцы и самки, соответствующие полу и возрасту, а также их однопометники дикого типа.Пометы должны быть рандомизированы с использованием любого программного обеспечения для рандомизации (например, www.random.org) для создания когорт из экспериментальных групп плацебо и лечения.

    Размер выборки

    Определите количество когорт животных, используя либо предыдущие исследования 7 , либо предпочтительно априорный расчет мощности в пилотных экспериментах (рис. S6 в 3 ).

    Лекарства

    Мы использовали Sephin1 (ацетатная соль; молекулярная масса: 256,93) один раз в день (5 мг / кг) или носитель (стерильная вода).Сефин1 следует приготовить путем растворения в воде (225 мг в 100 мл стерильной воды до конечной концентрации 2,25 мг / мл) с последующей обработкой ультразвуком (10 мин, 5 секунд ВКЛ; 5 секунд ВЫКЛ). Аликвоты можно заморозить. Аликвоты следует размораживать каждый день перед обработкой. Мы не рекомендуем замораживать и размораживать аликвоты. Поскольку средний вес мышей (в возрасте 6-7 недель) составлял 22,5 г, 50 мкл Sephin1 или носителя ежедневно вводили перорально отдельным мышам (для лечения 5 мг / кг) между 9.00 и 10.00 a.м. с помощью шприца объемом 1 мл, прикрепленного к пластиковой трубке для кормления (FTP-20-38, Instech Laboratories, Inc.). Другие препараты следует растворить, как было определено ранее, и после фармакокинетических исследований и фармакодинамического анализа необходимо будет определить соответствующую дозировку.

    ОБОРУДОВАНИЕ

    Роторный ускоритель (UGO BASILE, номер модели 47600, серийный номер 0767U08)

    ВАЖНО: Не меняйте инструменты между экспериментами. Небольшие изменения могут повлиять на результаты.

    Процедура

    Экспериментальная установка

    • 1

      Для настройки на каждый день тестирования держите мышей в их домашних клетках и переместите клетки в комнату для испытаний, чтобы мыши могли акклиматизироваться в комнате для испытаний по крайней мере в течение 60 мин.КРИТИЧЕСКИЙ Время должно быть таким, чтобы тесты проводились во время светового цикла.

    • 2

      Отметьте мышей на хвосте нетоксичными красными чернилами (I, II, III, IIII, IIIII)

      ВАЖНЫЙ ШАГ Не смешивайте полы в одном прогоне. Смешивание полов может повлиять на поведение мышей. Всегда начинайте с самцов, а не с самок.

    Привыкание

    • 3

      Для привыкания поместите животное на 1 мин на статический ротор и 1 мин на постоянной скорости (4 об / мин).Не менее чем через 10 минут повторите этот шаг (). КРИТИЧЕСКИЙ ШАГ Привыкание проводится только один раз перед проведением первого испытания.

    • 4

      Верните мышей в их домашние клетки и верните мышей в их домашнюю среду или перейдите к шагу 6. ​​

    • 5

      Очистите роторную машину с 70% EtOH между каждой группой мышей.

    Фаза обучения

    ВАЖНО: Мыши запоминают двигательные навыки после начального периода обучения.Таким образом, в лонгитюдных исследованиях обучающие испытания выполняются только один раз перед первым тестом.

    • 6

      Перенесите мышей в комнату для тестирования по крайней мере за час до тестирования, держа мышей в их домашних клетках.

    • 7

      Поместите мышей на стержень так, чтобы они бежали вперед, и установите устройство в режим ускорения от 4 до 40 об / мин за 300 с и запишите время ожидания падения. Верхний предел в 300 с на испытание был признан оптимальным для iSOD1 G93A , но может варьироваться в зависимости от модели мыши.

      ВАЖНЫЙ ШАГ: Продолжительность испытания может отличаться для разных моделей мышей. В использованных здесь мышах iSOD1 G93A продолжительность 300 с в тестах с вращающимся стержнем такова, что средняя задержка падения мышей дикого типа после периода обучения (после того, как повышение производительности между сеансами достигает плато) составляет 50 секунд. ниже максимальной продолжительности испытания. В пилотных экспериментах тесты могут проводиться на мышах с двигательными нарушениями и без них (трансгенные мыши и старые сопутствующие однопометники дикого типа в использованных примерах) на ускоряющем вращающемся стержне (4-40 об / мин) в течение 300 с.Если повторные испытания в этих условиях не позволяют выявить фенотип, продолжительность испытаний может быть увеличена до 600 и 900 с, продолжая с постоянной скоростью 40 об / мин. Как показано здесь, оптимальное время отсечки варьируется между различными моделями, но согласуется в пределах одной линии с очень небольшими вариациями внутри или между когортами, как показано здесь в различных представленных экспериментах.

    • 8

      Очищайте прибор после каждого цикла 70% EtOH. ВАЖНО: для получения объективных результатов машину следует чистить между каждой группой мышей.

    • 9

      Повторите шаги 7–8 дважды, обеспечивая по крайней мере 15-минутный интервал между испытаниями для каждой мыши.

      КРИТИЧЕСКИЙ ШАГ: Количество обучающих попыток может быть увеличено, если у мышей есть двигательный дефицит. Обучение считается завершенным, когда повышение успеваемости между сессиями достигает плато.

    • 10

      Верните мышей в домашние клетки и домашнюю среду на ночь.

    Этап тестирования

    • 11

      Повторите шаги 6–9 для трех испытаний, выполненных в течение трех дней подряд.Таким образом, в общей сложности необходимо провести 9 испытаний для оценки двигательных характеристик в данный момент времени (). Все эксперименты следует проводить при 4-40 об / мин за 300 с для iSODG93A и для CMT-1B за 900 с (300 с 4-40 об / мин и 600 с 40 об / мин). Выполните испытания, как описано на этапе обучения, с минимальным интервалом 15 минут между испытаниями.

    КРИТИЧЕСКИЙ ШАГ Продолжительность всего протокола (обучение и тестирование) зависит от тяжести двигательного дефицита мышей, который определяет продолжительность испытания, а также от количества животных.Например, в эксперименте с временем ускорения 300 с на испытание, как на мышах iSOD G93A , тестирование одной группы мышей (5 животных) занимает в общей сложности один час в течение трех последовательных дней, включая интервалы отдыха. Для одного эксперимента с группой из 40 мышей необходимые испытания займут не менее двух часов (запуск новых групп в интервалах отдыха предыдущих групп). При тестировании мышей с легким двигательным дефицитом, таких как мыши CMT-1B, продолжительность испытаний может быть больше. В случае мышей CMT-1B продолжительность экспериментов составляет около 6 часов для 40 мышей в день.

    Анализ

    • 12

      Анализируйте данные с помощью двустороннего дисперсионного анализа с повторными измерениями и апостериорной процедуры Бонферрони для корректировки множественных сравнений (программное обеспечение GraphPad Prism). Уровень значимости может быть установлен на * p <0,05, ** p <0,01, *** p <0,001, **** p <0,0001. Никакие образцы, мыши или точки данных не должны быть исключены из анализа. Первые испытания, соответствующие фазе обучения на вращающемся стержне (до тех пор, пока производительность не достигнет плато), необходимо исключить из количественного анализа для оценки двигательной активности без смешивающего эффекта фаз двигательного обучения.

    • 13

      Руководства ARRIVE необходимо соблюдать при составлении отчетов об исследованиях на животных 15 .

    ВРЕМЯ

    Тестирование одной группы мышей (5 животных) занимает 20 минут для привыкания (шаги 1–5) и 45 минут для трех испытаний (этапы 6–10 или 11) каждый день. Анализ (шаги 12-13) занимает 30-60 мин. [AU: Требуется информация о времени для всех шагов.]

    УСТРАНЕНИЕ НЕИСПРАВНОСТЕЙ

    Мыши могут цепляться за стержень вместо того, чтобы упасть. Мыши, выполняющие два полных пассивных оборота, цепляясь за стержень, указывают на нарушение двигательной функции.Когда это произойдет, остановите испытание этой мыши, нажав на рычаг, и запишите время. Необходимо сообщать обо всех исключенных мышах.

    ОЖИДАЕМЫЕ РЕЗУЛЬТАТЫ

    Путем оптимизации продолжительности испытаний и повторения анализов вращающихся стержней мы обнаружили, что меры на вращающихся стержнях чрезвычайно надежны и позволяют оценивать двигательные заболевания на меньшем количестве животных. Дефицит моторики может не наблюдаться в первых испытаниях, но становится очевидным и устойчивым при повторных испытаниях (и) с относительно меньшим количеством животных, чем при использовании других методов.Количественный характер qMotor позволяет измерять эффективность препарата на различных моделях мышей (и). Важно отметить, что чувствительность этого метода такова, что он позволяет обнаруживать двигательные нарушения при отсутствии видимых симптомов (и). Таким образом, qMotor можно использовать для определения гуманных конечных точек в экспериментах, что позволяет уточнить протоколы и уменьшить страдания животных и уменьшить их количество. Этот метод применим к множеству различных моделей заболеваний, связанных с двигательными нарушениями.

    Поиск компании Подписка

    Сожалеем, но ваш компьютер или сеть могут отправлять автоматические запросы. Чтобы защитить наш сайт, мы не можем обработать ваш запрос прямо сейчас. Если вам нужен поиск на уровне предприятия, рассмотрите возможность регистрации учетной записи Bizapedia Pro Search, как описано на этой странице.

    НЕОГРАНИЧЕННЫЙ ПОИСК
    С помощью службы Bizapedia Pro Search ™ вы получите неограниченное количество поисковых запросов через наши различные формы поиска, количество запросов в которых может быть увеличено до 5 раз. максимальное количество совпадений за поиск vs.не подписчики. Кроме того, если мы собрали «Информацию о потенциальных покупателях» для данной компании, она будет отображается на странице профиля компании вместе с остальными общими данными.

    Рекламные ссылки

    ДОСТУП К ПРЕДПРИЯТИЮ
    Весь ваш офис сможет использовать вашу поисковую подписку.Кроме того, все страницы Bizapedia будут обслуживаться вам полностью без рекламы. и вам будет предоставлен доступ для просмотра каждого профиля целиком, даже если компания решит скрыть личную информацию в своем профиле от широкой публики.
    БЕСПЛАТНЫЙ ПОИСК RECAPTCHA
    После входа в систему и аутентификации вас не будут просить решать какие-либо сложные задачи Recaptcha V2.
    ФОРМА РАСШИРЕННОГО ПОИСКА
    Используйте нашу форму расширенного поиска, чтобы отфильтровать результаты поиска по названию компании, городу, штату, почтовому индексу, юрисдикции подачи заявки, типу юридического лица, зарегистрированному агенту, Номер файла, статус подачи и бизнес-категория.

    BIZAPEDIA
    PRO SEARCH
    Выполняйте неограниченный поиск через нашу форму расширенного поиска
    с помощью
    Search Bizapedia.
    ЧТО ВКЛЮЧЕНО В ФОРМУ РАСШИРЕННОГО ПОИСКА?
    & проверить; НАЗВАНИЕ КОМПАНИИ & проверить; ТИП ОБЪЕКТА
    & проверить; ЮРИСДИКЦИЯ & проверить; НОМЕР ДЕЛА
    & проверить; СТАТУС ЗАЯВКИ
    & проверить; ЗАРЕГИСТРИРОВАННОЕ ИМЯ АГЕНТА & проверить; ГЛАВНЫЙ АДРЕС ГОРОДА
    ГОСУДАРСТВО И ПОЧТОВЫЙ ИНДЕКС
    & проверить; ГОРОД РЕГИСТРАЦИИ АГЕНТА, ГОСУДАРСТВО
    И ПОЧТОВЫЙ ИНДЕКС
    & проверить; ПОЧТОВЫЙ АДРЕС ГОРОД
    ГОСУДАРСТВЕННЫЙ И ПОЧТОВЫЙ ИНДЕКС

    Если вы ищете что-то большее, чем поисковая утилита в Интернете, и вам нужно автоматизировать поиск компаний и сотрудников изнутри вашего внутренние приложения, то наш Bizapedia Pro API ™ на основе B2B может стать для вас ответом.

    QMotor.com запускает первое мобильное приложение

    Q Motor, один из ведущих автомобильных сайтов в Катаре, объявил о запуске своего первого мобильного приложения, бесплатного интерактивного инструмента, который позволяет автомобильным охотникам в Катаре просматривать тысячи автомобилей, выставленных на продажу. Приложение также позволяет пользователям выставлять свои автомобили на продажу за четыре очень простых шага. Новое мобильное приложение доступно в Интернете в Apple Store и Google Play под названием «QMotor».

    «Мы всегда ищем способы сэкономить время наших клиентов и улучшить опыт поиска автомобилей, и это начинается с покупки и продажи одним нажатием кнопки», — сказал Анас Аль Хадж, управляющий директор QMotor.com. «Приложения QMotor для iPhone и Android — еще один быстрый и простой способ найти новую машину или продать свой старый, когда вы в пути. Попрощайтесь с ожиданием в жару, пока кто-то фотографирует вашу машину! » — добавил г-н Аль-Хадж.

    Мобильное приложение Android от QMotor — первое приложение Android в Катаре в автомобильной промышленности.Приложение уникально, потому что QMotor.com был первым, кто предложил эту услугу для пользователей Samsung, Sony и HTC, которые составляют более 70% мобильных пользователей в Катаре. Приложение для Android было спроектировано и разработано в соответствии со стандартами и рекомендациями . Приложение QMotor имеет функции :

    — Просмотр подержанных и новых автомобилей, имеющихся в наличии для продажи

    — Выставление автомобилей на продажу и редактирование, удаление или маркировка рекламы как продал.

    — Просмотр и перечисление специальных номерных знаков

    — Просмотр автомобильных дилеров в Катаре

    Мобильное приложение QMotor было создано на основе QMotor.com, предлагая автомобильным охотникам возможность сэкономить время, и это было примером слогана QMotor «Ведущий веб-сайт и мобильное приложение в Катаре». Мобильное приложение представляет собой оптимизированную версию QMotor.com и было разработано для всех смартфонов и цифровых планшетов.

    С момента запуска QMotor.com в 2014 году было создано более 95 000 индивидуальных учетных записей. Веб-сайт посещают 14 000 посетителей в день, при этом через веб-сайт и мобильное приложение загружается более 70 автомобилей в день.

    Для получения дополнительной информации о приложениях QMotor для iPhone и Android посетите http://apps.qmotor.com/

    О QMotor:

    Действующий с 2014 года веб-сайт Q Motor и мобильное приложение является ведущим автомобильным веб-сайтом Катара с ежемесячными пользователями. до 500000. Эта сильная позиция означает, что Q Motor управляет одним из ведущих рынков Катара для автомобилистов и предлагает непревзойденный отклик на рекламу клиентов.

    Q Motor предоставляет маркетинговые и программные решения автомобильным дилерам по всему Катару.Предлагаемые услуги облегчают покупку и продажу автомобилей и автомобилей со специальными номерами. Q Motor также является порталом номер один в Катаре по аренде автомобилей. Мы стремимся значительно улучшить то, как люди покупают, продают и арендуют новые и подержанные автомобили в Катаре.

    Следите за нами в наших социальных сетях: @ILQlive @ILQlive @ILoveQtr ILoveQatar

    Q Motors, 580 Leek Rd, Сток-он-Трент, телефон +44 1782 285613

    Джанни

    29 июля 2021 20:03

    Ничего себе, это место было отличным, пошел на проверку автомобиля RAC.Создан для того, чтобы почувствовать себя действительно желанным гостем, эффективная работа и отличный персонал / владелец. Будем активно стремиться использовать этот гараж для обслуживания, даже если он находится в 20 милях от дома. Произведено большое впечатление

    пользователь

    20 марта 2021 17:27

    Великолепное, вежливое обслуживание. Только что купил у этих парней прекрасный Vauxhall Corsa. Так полезно! Машину собрали и подготовили (ТО, замена масла и т. Д.), Чтобы я мог забрать ее на следующий день. Действительно доволен.Спасибо!

    игры

    17 марта 2021 21:11

    Был здесь дважды, только для небольших, незначительных проблем, но оба раза получил абсолютное 5-звездочное обслуживание. Всем рекомендую. Персонал очень услужливый и дружелюбный.

    C Фернандо

    14 февраля 2021 1:07

    Был здесь от трех до трех раз, чтобы купить пикап. Никто не хочет с вами разговаривать, кажется, никто не заботится о покупателе.Поговорил с парнем на задней стоянке машин, он не может мне помочь найти кого-нибудь.

    Взял бы Рейнджер и HiLux. Их потеря.

    Стюарт

    06 сентября 2020 23:26

    Я видел буксирную машину Peugeot 208 с 13 рег. С тормозной рамой на eBay, отправил 2 вопроса на eBay без ответа, я позвонил, и парень, который ответил, сказал, что вам нужно поговорить с Дейлом, заставит его позвонить вам в тот день я не перезвонил Я позвонил на следующий день поговорил с Дейлом, который казался искренним, он сказал, что он все еще продается, сказал ему, что я только что купил дом на колесах, поэтому мне нужен эвакуатор, я сказал, что мне нужно поговорить с моим сыном о подошел ко мне, перезвонил ему, чтобы сказать, что мы не сможем быть там до полудня понедельника, он сказал, что у него есть изрядный интерес, но предложил внести залог в размере 250 фунтов стерлингов, что я и сделал, в обеденное время в понедельник я позвонил ему перед отъездом сказал, что буду там около 3.30 пришел, чтобы найти знак продано на машине, подумал, что это было повесили там, потому что я положил на нее залог, мой сын, и я осматривал машину, от которой вышел Дейл, и оказалось, что он продал машину кому-то в противном случае он тогда вернулся в свой офис там на некоторое время вернулся с куском документов, предполагающим, что он поставил меня смотреть на Skoda Octavia Peugeot 208, который был единственным буксирным автомобилем, который у него был там после разговора в четверг для Причина, по которой я этого хотел, я даже не мог увидеть Skoda Octavia на его сайте, кстати, я предложил немного денег на топливо и дорожные сборы, он ответил, что я обычно не делаю этого, он отказался от моего банка подробности вернули мой депозит ничего сверх того, что я потратил мое время и деньги # идиот # пустая трата времени # это даже не торгуется как Q Cars

    ИЗБЕГАЙТЕ ИЗБЕГАЙТЕ ИЗБЕГАЙТЕ

    Стив

    03 сентября 2020 5:26

    Ужасный опыт, и я никогда больше не буду использовать или покупать их, если бы у меня были неисправные часы, поэтому я не мог видеть скорость или Speedo, и они хотели, чтобы мы заплатили 1000 фунтов стерлингов за ремонт, а у нас даже не было машины неделю заставили АА составить полный отчет, и они сказали, что джип непригоден для эксплуатации и опасен, что у него так много проблем, а также плохой ремонт и временный ремонт, поэтому мы отказались от автомобиля, и финансовая компания вернула им джип, и им пришлось возместить финансовой компании ужасному клиенту навыки не были заинтересованы в решении проблем, когда вы их устраняли.это показывает, что они все еще изворотливые переулки, гараж им не дал бы 1 звезду

    Пол

    01 июля 2020 19:40

    Это чудесный гараж и внимательный персонал, который старается изо всех сил, чтобы помочь вам, порекомендовал бы владельца Дейла и его команду всем потенциальным покупателям автомобилей

    Свеча

    04 марта 2020 17:42

    Очень симпатичный механик, хотя я не могу вспомнить его имя, все же он казался честным человеком.Он быстро осмотрел мою машину и назначил мне приличную цену. Вы можете сказать, что он действительно заботится о том, что делает, и, вероятно, считает клиента удовлетворительным. Он ЗНАЕТ, что делает, когда дело доходит до автомобилей, чего я не могу сказать о многих механиках, которые создают неисправности в вашей машине только для того, чтобы иметь ваши деньги, особенно большие гаражи, которые заряжают и вооружают и ногу за глупость. . Я уверен, что кто-то знает, о чем я говорю. В любом случае ДА РЕКОМЕНДУЮ этот гараж.

    Бекки

    03 марта 2020 22:41

    Квинтон больше не принадлежит, гаражом управляет другое подразделение, и они не очень помогли, когда я посетил

    Ричард

    02 ноября 2019 12:30

    Автомобили в очень хорошем состоянии и обслуживаются по высоким стандартам, и все автомобили по умеренным ценам, персонал в гараже очень услужливый и вежливый, очень их порекомендует.

    олучи

    27 июня 2017 18:32

    Тот же опыт, что и я, я и мой муж пришли к ним незадолго до Рождества 2015 года, они были очень милы и всегда готовы помочь. Мы получили vauxhall merivia 2010 года, и через год это был блестящий опыт. Через некоторое время мне заменили дворник ветрового стекла, и парень не особо волновался по этому поводу, я обязательно воспользуюсь им, если мне понадобится вторая машина в будущем, но я молюсь, чтобы в следующий раз я мог позволить себе совершенно новый такой же уход.

    Гэри

    02 июня 2017 23:44

    Я купил здесь в апреле 2016 года машину шестилетней давности. Они обеспечивают очень хорошее и честное обслуживание клиентов, автомобиль был проверен и отполирован перед продажей, и они немедленно исправили все небольшие проблемы, которые у меня были с ним, без суеты. Наличие небольшого представительства позволяет этим ребятам без компромиссов заботиться о своих клиентах, и мне очевидно, почему они занимаются бизнесом уже 30 лет.Я приеду сюда первым за своей следующей машиной, и я очень рекомендую их всем, кто покупает подержанную машину.

    qmotor.com — Автомобили в Катаре — Q Motor | Ø³ÙŠØ§Ø ± ات Ù ÙŠ Ù‚Ø · Ø ±

    Полезный список орфографических ошибок в расширении TLD

    qmotor.ru, qmotor.net, qmotor.org, qmotor.de, qmotor.jp, qmotor.uk, qmotor.br, qmotor.pl, qmotor.in, qmotor.it, qmotor.fr, qmotor.au, qmotor. info, qmotor.nl, qmotor.ir, qmotor.cn, qmotor.es, qmotor.cz, qmotor.ua, qmotor.ca, qmotor.kr, qmotor.eu, qmotor.biz, qmotor.za, qmotor.gr, qmotor.co, qmotor.ro, qmotor.se, qmotor.tw, qmotor.vn, qmotor.mx, qmotor.tr, qmotor.ch, qmotor.hu, qmotor.at, qmotor.be, qmotor.tv, qmotor.dk, qmotor.me, qmotor.ar, qmotor.sk, qmotor.us, qmotor.no, qmotor.fi, qmotor.id, qmotor.xyz, qmotor.cl, qmotor. Автор:, qmotor.nz, qmotor.ie, qmotor.il, qmotor.pt, qmotor.kz, qmotor.my, qmotor.lt, qmotor.io, qmotor.hk, qmotor.cc, qmotor.sg, qmotor.edu, qmotor.pk, qmotor.su, qmotor.рф, qmotor.bg, qmotor.th, qmotor.top, qmotor.lv, qmotor.hr, qmotor.pe, qmotor.rs, qmotor.club, qmotor.ae, qmotor.si, qmotor.az, qmotor.ph, qmotor.pro, qmotor.ng, qmotor.tk, qmotor.ee, qmotor.mobi, qmotor.asia, qmotor.ws, qmotor.ve, qmotor.pw, qmotor.sa, qmotor.gov, qmotor.cat, qmotor.nu, qmotor.ma, qmotor.lk, qmotor.ge, qmotor.tech, qmotor.online, qmotor. uz, qmotor.is, qmotor.fm, qmotor.lu, qmotor.am, qmotor.bd, qmotor.to, qmotor.ke, qmotor.name, qmotor.uy, qmotor.ec, qmotor.ba, qmotor.ml, qmotor.site, qmotor.do, qmotor.website, qmotor.mn, qmotor.mk, qmotor.ga, qmotor.ссылка, qmotor.tn, qmotor.md, qmotor.travel, qmotor.space, qmotor.cf, qmotor.pics, qmotor.eg, qmotor.im, qmotor.bz, qmotor.la, qmotor.py, qmotor.al, qmotor.gt, qmotor.np, qmotor.tz, qmotor.kg, qmotor.cr, qmotor.coop, qmotor.today, qmotor.qa, qmotor.dz, qmotor.tokyo, qmotor.ly, qmotor.bo, qmotor. cy, qmotor.news, qmotor.li, qmotor.ug, qmotor.jobs, qmotor.vc, qmotor.click, qmotor.pa, qmotor.guru, qmotor.sv, qmotor.aero, qmotor.work, qmotor.gq, qmotor.ag, qmotor.jo, qmotor.rocks, qmotor.ps, qmotor.kw, qmotor.om, qmotor.ninja, qmotor.af, qmotor.media, qmotor.so, qmotor.win, qmotor.life, qmotor.st, qmotor.cm, qmotor.mu, qmotor.ovh, qmotor.lb, qmotor.tj, qmotor.gh, qmotor.ni, qmotor.re, qmotor.download, qmotor.gg, qmotor.kh, qmotor.cu, qmotor.ci, qmotor.mt, qmotor.ac, qmotor.center, qmotor.bh, qmotor. hn, qmotor.london, qmotor.mo, qmotor.tips, qmotor.ms, qmotor.press, qmotor.agency, qmotor.ai, qmotor.sh, qmotor.zw, qmotor.rw, qmotor.digital, qmotor.one, qmotor.sn, qmotor.science, qmotor.sy, qmotor.red, qmotor.nyc, qmotor.sd, qmotor.tt, qmotor.moe, qmotor.world, qmotor.iq, qmotor.zone, qmotor.mg, qmotor.academy, qmotor.mm, qmotor.eus, qmotor.gs, qmotor.global, qmotor.int, qmotor.sc, qmotor.company, qmotor.cx, qmotor.video, qmotor.as, qmotor.ad, qmotor.bid, qmotor.moscow, qmotor.na, qmotor.tc, qmotor.design, qmotor. mz, qmotor.wiki, qmotor.trade, qmotor.bn, qmotor.wang, qmotor.paris, qmotor.solutions, qmotor.zm, qmotor.city, qmotor.social, qmotor.bt, qmotor.ao, qmotor.lol, qmotor.expert, qmotor.fo, qmotor.live, qmotor.host, qmotor.sx, qmotor.marketing, qmotor.education, qmotor.gl, qmotor.bw, qmotor.berlin, qmotor.blue, qmotor.cd, qmotor.kim, qmotor.land, qmotor.directory, qmotor.nc, qmotor.guide, qmotor.mil, qmotor.pf, qmotor.network, qmotor.pm, qmotor.bm, qmotor.events, qmotor.email, qmotor.porn, qmotor.buzz, qmotor.mv, qmotor. party, qmotor.works, qmotor.bike, qmotor.gi, qmotor.webcam, qmotor.gal, qmotor.systems, qmotor.ht, qmotor.report, qmotor.et, qmotor.pink, qmotor.sm, qmotor.jm, qmotor.review, qmotor.tm, qmotor.ky, qmotor.pg, qmotor.pr, qmotor.tools, qmotor.bf, qmotor.je, qmotor.tl, qmotor.photos, qmotor.pub, qmotor.tf, qmotor.cool, qmotor.fj, qmotor.reviews, qmotor.support, qmotor.watch, qmotor.yt, qmotor.date, qmotor.technology, qmotor.укр, qmotor.mr, qmotor.services, qmotor.photography, qmotor.vg, qmotor.community, qmotor. gd, qmotor.lc, qmotor.help, qmotor.market, qmotor.photo, qmotor.codes, qmotor.dj, qmotor.mc, qmotor.gallery, qmotor.wtf, qmotor.uno, qmotor.bio, qmotor.black, qmotor.bzh, qmotor.gratis, qmotor.ink, qmotor.mw, qmotor.audio, qmotor.plus, qmotor.chat, qmotor.domains, qmotor.gy, qmotor.ooo, qmotor.tel, qmotor.training, qmotor.онлайн, qmotor.deals, qmotor.taipei, qmotor.cash, qmotor.gift, qmotor.scot, qmotor.sr, qmotor.camp, qmotor.cloud, qmotor.house, qmotor.vu, qmotor.bi, qmotor.careers, qmotor.team, qmotor. istanbul, qmotor.museum, qmotor.love, qmotor.москва, qmotor.coffee, qmotor.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *