Menu

Forskolin forum: Life Extension, форсколин, 10 мг, 60 вегетарианских капсул

Содержание

Форсколин/Coleus Forskolin отзывы

Подробное описание API Labs ФОРСКОЛИН 10% 300 мг (Coleus ForsKolin), 60 капсул

ФОРСКОЛИН — является мощным активным веществом индийского растения Coleus forscohlii. Независимые исследования подтвердили, что форсколин улучшает состав тела и за счет увеличения мышечной массы, и за счет снижения жировой массы. Форсколин активирует фермент аденилатциклазу, которая, в свою очередь, активирует цАМФ (циклический аденозинмонофосфат). Увеличение цАМФ активирует гормон-чувствительной липазы (HSL), который разрушает триглицериды (жир) хранящиеся в жировых депо, и освобождает жирные кислоты, поэтому они могут окисляться и процент жира в теле может быть уменьшен.

      основные эффекты форсколина:

  1. Форсколин способствует снижению жировой массы тела (без побочных эффектов), входит в состав самых эффективных жиросжигателей.
  2. Сохраняет мышечную массу тела на этапе жиросжигания и может использоваться для роста сухой мускулатуры на стадии набора веса.
  3. Сосудорасширяющий эффект, который также очень полезен для здоровья как интимного, так и общего здоровья человека, так как за счет этого улучшается питание всех органов и мышц (уместно в бодибилдинге).
  4. Форсколин повышает устойчивость к действию ультрафиолетового излучения, делая загар более темным.
  5. Подавляет инфекции мочеполовой системы. Может применяться в комбинации с антибиотиками.
  6. Противоопухолевый эффект
  7. Форсколин восстанавливает периферические нервные волокна.(это важно в спорте- если Вы ходите в спортзал, то форсколин сделает Ваш период восстановления короче и Вы сможете тренироваться чаще, быстрее набирая мышечную массу)
  8. Полезен при астме —  облегчает течение болезни 

      В нашем магазине можно купить очень качественный форсколин из Канады, прошедший все клинические испытания, цена на форсколин самая низкая, отзывы положительные.

     

      В данной упаковке содержится:

      60 капсул по 300мг корня колеуса и содерит в себе 30 мг активного форсколина,т.е. стандартизировано под 10% экстракт


           Дозировка и режим приема

      Дозы экстракта зависят от процента стандартизации. Как правило, экстракт корня Coleus forskohlii стандартизируется под 10% форсколина,  рекомендуется принимать 300 мг 2 раза в день, т.е. 30 мг активного вещества 2 раза в день, за 30 минут до еды, либо непосредственно перед физической активностью. Суточная доза не должна превышать 1000 мг экстракта форсколина.

Форсколин способен значительно усилить эффект любого жиросжигателя, а также добавок повышающих секрецию собственного тестостерона.    


Форсколия (Колеус форсколии)

Состав

Колеус форсколии обычно используется благодаря своему активному компоненту форсколину, который является прямым активатором аденилатциклазы. Форсколин, который также называется колеонол, содержится в разной концентрации в растениях колеуса форсколии. Надземная часть растения (листья и стебель) содержит: ряд родственных соединений форсколина (A,G,H,I,J) и изофорсколин. Основное соединение форсколина, использующееся в исследованиях, имеет химическое название – 7β-ацетокси-1α, 6β, 9α-тригидрокси-8,13-эпокси-лабд-14-эн-11-он. Ряд дитерпеновых структур форскодитерпенозидов (A,C,D,E), (16S)-колеон E, 4β,7β,11-энантиоевдесмантриол, розмариновая кислота (листья), абиетановые дитерпеноиды, хамаецидин, скутеллареин в форме 4′-метильного эфира 7-O-глюкуронида, лютеолин в форме 7-O-глюкуронида, апигенин в форме 7-O-глюкуронида, акацетин в форме 7-O-глюкуронида, альфа-цедрен, олеаноловая кислота и бетулиновая кислота, бета-ситостерол. В корне растения содержатся: 14-деоксиколеон U, диметилкриптояпнол, альфа-амирин и альфа-цедрол, бетулиновая кислота, бета-ситостерол.

Свойства

Форсколин хорошо всасывается в желудочно-кишечном тракте при пероральном приеме, может абсорбироваться на любом участке кишечника и толстой кишки, но в двенадцатиперстной кишке наблюдается наивысшая степень поглощения. Действие форсколина зависит от оттока P-гликопротеина в кишечнике, и совместный прием с ингибитором P-гликопротеина может повысить пероральную биодоступность форсколина.

Форсколин является стимулятором аденилциклазы (синоним аденилатциклазы), которая повышает уровень циклического аденозинмонофосфата (цАМФ) в клетках. Это очень надежный и высокоэффективный агент, который часто используется в исследованиях в качестве инструмента для изучения повышения цАМФ в клетке. Повышение цАМФ не повышает липолиз при низкой концентрации 0,1-1мкм, но при 10 мкм он может индуцировать липолиз самостоятельно. Низкие концентрации эффективно повышают липолиз только в сочетании с β2-адренергическими агонистами, это говорит о том, что жиросжигающий эффект форсколина зависит от высокой дозировки или наличия других агентов (экзогенных и/или эндогенных). Листья форсколии (обычно используют корень) способны ингибировать активность ацетилхолинэстеразу благодаря наличию розмариновой кислоты в составе. Форсколин способен активировать аденилатциклазу в сердечной мышце, а также проявляет положительное ионотропное действие при лечении сердечной недостаточности.

Применение

Прием колеуса форсколии может вызвать повышение кислотности желудка, и не рекомендуется лицам, страдающим язвой желудка.

Несмотря на малое количество исследований с участием человека, они весьма многообещающие. Исследование с участием женщин с избыточным весом показало, что два приема 10 % экстракта по 250 мг могут снизить увеличение веса. У мужчин с избыточным весом такая же дозировка вызывает значительные изменения в теле при приеме в течение 12 недель. В группе, которая принимала колеус форсколии, также наблюдалось повышение тестостерона и костной массы. Исследование, не направленное на изучение потери веса, отметило, прежде всего, что прием 500-700 мг колеуса форсколии в течение 2 месяцев снижает индекс массы тела на 2,4-2,6 %. Между людьми с избыточным весом и здоровыми людьми может быть значительное различие, так как первые имеют более низкую активность аденилатциклазы в жировых клетках, но при потере веса посредством снижения количества потребляемых калорий эта ситуация изменяется. Мужчины имеют преимущество перед женщинами, так как тестостерон может действовать в качестве жиросжигателя.

Исследование отметило снижение внутриглазного давления (ВГД) у людей, которые использовали глазные капли, содержащие форсколин (1 % 50 мкл раствора), форсколин при этом действовал в роли активатора аденилатциклазы. Было сделано предположение, что роль форсколина заключается в повышении скорости реакции ганглионарных клеток сетчатки (ГКС) к стимуляции от НФМ, так как сигнал НФМ в этих клетках передается посредством цАМФ, но увеличение внеклеточного уровня НФМ эффективно регенерирует эти клетки и отрицательно регулирует рецептор TrkB. Отмечалось снижение ВГД на 20 % при пероральном приеме форсколина (200 мг 10 % форсколина), 200 мг рутина и двух витаминов B (тиамин и рибофлавин, 550 мкг и 700 мкг соответственно) в течение 40 дней у лиц с первичной открытоугольной глаукомой, другие исследования, использующие эти препараты, воспроизвели результаты описанного исследования. Эффективность повышается при использовании в дополнение к стандартной терапии, а прием более одного месяца снижает ВГД в среднем на 10%. Необходимы дальнейшие исследования, где форсколин использовался бы без других веществ, более длительное использование препарата помогает оценить риск резистентности.

Литература
Pescosolido N, Librando A. Oral administration of an association of forskolin, rutin and vitamins B1 and B2 potentiates the hypotonising effects of pharmacological treatments in POAG patients // Clin. Ter. (2010)
Shen Y.H., Xu Y.L. Two new diterpenoids from Coleus forskohlii // J Asian Nat Prod Res. (2005)
Shan Y. et al. Two minor diterpene glycosides and an eudesman sesquiterpene from Coleus forskohlii // Chem Pharm Bull (Tokyo). (2007)
Rosmarinic acid, scutellarein 4′-methyl ether 7-O-glucuronide and (16S)-coleon E are the main compounds responsible for the antiacetylcholinesterase and antioxidant activity in herbal tea of Plectranthus barbatus (“falso boldo”)
Stability of Forskolin in Lipid Emulsions and Oil/Water Partition Coefficients

Burns T.W. et al. Alpha-2 adrenergic activation inhibits forskolin-stimulated adenylate cyclase activity and lipolysis in human adipocytes // Life Sci. (1982)
Dubey M.P. et al. Pharmacological studies on coleonol, a hypotensive diterpene from Coleus forskohlii // J Ethnopharmacol. (1981)
Fredholm B.B., Jonzon B., Lindström K. Effect of adenosine receptor agonists and other compounds on cyclic AMP accumulation in forskolin-treated hippocampal slices // Naunyn Schmiedebergs Arch Pharmacol. (1986)
Alexander S.P1. et al. A1 adenosine receptor inhibition of cyclic AMP formation and radioligand binding in the guinea-pig cerebral cortex // Br J Pharmacol. (1994)


последние отзывы, механизм действия, побочные действия

В преддверии нового летнего сезона все отправляются по магазинам, чтобы обновить свой гардероб. И неприятным сюрпризом может стать изменившаяся не в лучшую сторону за зиму фигура. Конечно, для диеты и походов в спортивный зал времени уже нет. Требуется что-то одновременно эффективное и безопасное. Что-то, что поможет легко и без особых усилий вернуть былые формы.

Сегодня в интернете активно рекламируется БАД «Форсколин», отзывы о котором можно встретить уже и на тематических форумах. Иными словами, люди пробуют и выкладывают свои результаты. Насколько добавка эффективна – расскажем в следующих разделах.

Что это такое?

Разобраться оказалось не так и просто. При попытке забить это словосочетание в поисковик можно наткнуться на сотни сайтов, отзывов, рекламных статей. И ничего конкретного. Поэтому начнем с самого начала. Из чего он состоит? БАД «Форсколин» в отзывах называют самым натуральным и безопасным средством на сегодняшний день. Действительно, это биологически активное соединение, которое продуцируется растением семейства Мятных, которое произрастает в Индии.

Научный подход

Но растительное происхождение — еще не гарантия безопасности. Но в данном случае были проведены многочисленные исследования, результаты которых были обнародованы уже давно. Еще и этим можно объяснить положительные отзывы о «Форсколине». Потребителю очень важно знать, что именно ему предлагают употреблять и чем это чревато для его здоровья.

Но и безопасность не равна эффективности. На самом деле у этого препарата нет мифической силы, разрушающей подкожный жир. Но он все равно имеет ряд преимуществ как связанных, так и не связанных с потерей веса. Очень ценным является то, что производители сочли необходимым проверить эффективность препарата экспериментальным путем, после чего каждый может сделать вывод для себя сам.

Действительно ли препарат «волшебный»?

Отзывы о «Форсколине» нельзя рассматривать без описания легенды, с которой он выходил на рынок. С экранов телевизора популярный диетолог представил эту добавку как «молнию в бутылке». Конечно, это подхватили и многие другие специалисты в области здорового питания, и только меньшинство начало собирать статистику и факты перед тем, как советовать его своим пациентам. Итак, реклама обещала потерю веса до 4,5 кг за одну неделю. Весьма заманчиво, что и говорить.

Но не стоит забывать о том, что пища – это тоже лекарство. Воздействие продуктов питания и натуральных веществ на наши тела намного больше, чем мы могли бы себе представить. Поэтому очень важно знать, что наука говорит о воздействии питательных веществ, таких как форсколин. Истина заключается в том, что он имеет различные преимущества, но его роль в потере веса вовсе не такая волшебная, как говорит реклама.

Воздействие на организм

Прежде чем переходить к отзывам о «Форсколине» для похудения, неплохо понять, как эти капсулы с экстрактом колеуса воздействуют на наш организм. Уже исходя из этого можно делать вывод о том, поможет ли он в вопросах сжигания лишнего жира. Итак, это биологически активное соединение, добываемое из растения, которое используется в медицинских целях и в спорте.

Свое действие на организм вещество проявляет в первую очередь за счет активации фермента аденилатциклазы. Он обеспечивает хорошую транспортировку гормонов. Гормональный фон приходит в норму, а затем и обмен веществ. Помимо этого, можно отметить еще целый ряд доказанных эффектов, которые мало что скажут человеку без медицинского образования. Поэтому немного опустим их и перейдем к главному. Благодаря подобному соединению происходит увеличение синтеза тестостерона. В результате наблюдается прирост мышечной массы и уменьшение жировой прослойки, улучшается питание мышц.

Диета и спорт

Как бы нам не хотелось избежать этого, но в вопросах похудения мы всегда приходим к необходимости менять образ жизни. Реальные отзывы о «Форсколине» говорят о том, что без коррекции питания вам не удастся добиться значимых результатов.

Это выглядит довольно убедительно. Ведь если говорить о приросте мышечной массы, которая происходит за счет переработки жировой прослойки, то катализатором является повышение физической нагрузки. Сидя дома с чаем и пирожными, вы можете даже не надеяться на положительные результаты. Как обычно — разочарование.

Эксперименты

Чтобы проверить эффективность выделенного вещества, было поведено несколько исследований. Было важно сделать заключение — способен ли подобный растительный экстракт внести свой вклад в современный бодибилдинг.

Отзывы о «Форсколине» не самые обнадеживающие. Получается что те, кто правильно питается и занимается сортом, достигает своих результатов. Но нельзя сказать, что, используя эту добавку, они делают это быстрее других. Но мы немного отвлеклись. Давайте перейдем к исследованиям.

Эксперимент на крысах

Это было первое исследование, в котором принимали участие только грызуны. Результаты были очень вдохновляющими. Сразу было объявлено, что найдено самое эффективное вещество для борьбы с лишним весом. Вещество, выделенное из растения, позволяло предупредить ожирение на фоне обильного и высококалорийного питания. Но дозировка была очень высокая, аналогичных экспериментов на человеке не проводилось.

Исследование на мужчинах

Второй экспериментальной группой стали представители сильного пола. Были собраны добровольцы, которые образовали экспериментальную и контрольную группу. Результат оказался не таким, как ожидалось, но все-таки существенным. Отмечено повышение уровня тестостерона, а также положительное воздействие на соотношение мышечной и жировой массы тела.

В исследовании принимали участие 30 мужчин с ожирением. Их разделили на две равные группы. Одна получала форсколин по 250 мг дважды в день, а другая пустышку. Через 12 недель в группе, принимавшей добавку по 250 мг два раза в день, было отмечено статистически значимое повышение уровня тестостерона, увеличение мышечной массы и уменьшение подкожной жировой прослойки.

Оценка результата

Отзывы о «Форсколин DHC» во многом опираются именно на это исследование. На него ссылаются фирмы, которые занимаются реализацией подобной добавки. Именно эти данные приводятся в информационных и рекламных статьях, которые восхваляют добавки на основе форсколина. На самом деле осталось много вопросов, на которые нет ответов:

  • Почему при первоначальном исследовании в первой группе, принимающей «Форсколин», у мужчин уровень тестостерона был выше.
  • Почему в группе, принимающей пустышки, у мужчин росла мышечная масса. Ведь они не занимались спортом.
  • Если это средство для похудения, то снова неувязка. В группе мужчин, принимающих добавку, не было отмечено снижение массы тела.

То есть исследование имеет низкую степень достоверности, и об этом свидетельствуют отзывы врачей. «Форсколин» — это очередная пустышка, которую раскрутили благодаря маленькому и недорогому эксперименту. Тем более что проведен он был с нарушениями, и по его результатам нельзя делать выводы о клинической эффективности препарата.

Исследование на женщинах

Третья группа была собрана из представительниц прекрасной половины человечества. Оно показало высокий уровень безопасности. Правда в результате никто так и не похудел. Принимали участие 23 женщины. Из них только 7 человек принимали добавку. Дозы и длительность при этом не меняли. Но результаты оказались неутешительными. Масса тела не изменилась, соотношение жира и мышц тоже. Но не было отмечено побочных эффектов, что тоже является важным моментом для многих женщин.

Вывод можно сделать следующий, по отзывам американских врачей: «Форсколин» нельзя назвать эффективным средством. Его можно использовать для наращивания массы тела или с целью похудения исключительно «на удачу».

А что говорят худеющие

Исследования и официальные выводы — это одно. Но есть и отзывы худеющих. «Форсколин» они уже опробовали на своем опыте и могут поделиться своими выводами с другими. Первым делом отмечают дизайн упаковки. Однозначно это самый красивый БАД который вам доводилось держать в руках. Матовый угольный фон и глянцевые цветные элементы с изображением растений. Дизайнеры постарались на славу.

Баночка закрыта крышкой, под которой скрывается мембрана, а затем кусок ваты. Только после этого можно добраться до самих таблеток. Сами капсулы обычного размера, прозрачные. Глотать их легко, особенно если запивать водой. Никаких неприятных ощущений, привкусов или дискомфорта в животе тоже нет.

Эффективность

Отрицательные отзывы о «Форсколине» подчеркивают именно отсутствие результата. Ни снижения аппетита, ни сжигания жировой прослойки — вообще ничего. Вечерний повышенный аппетит тоже остается с вами. Иными словами, выпиваете ли вы стакан воды или запиваете им таблетку — эффект равносильный.

Кстати, когда содержимое баночки начинает подходить к концу, можно зайти на страницу покупки и оставить свой отзыв. Некоторые покупатели отмечают, что после того, как оставили свой честный отзыв, им начали писать представители компании и предлагать бесплатно две такие баночки, чтобы можно было продолжить курс и оценить результат. Но если ноль помножить на два, все равно получится ноль, поэтому большинство отказывались.

Эффект плацебо

Нельзя отрицать его наличие и воздействие на организм. Если вы искренне верите в то, что эти капсулы помогут стать стройней, то будете бессознательно стремиться помочь им в этом. Конечно, если принимать их вместо еды, чего делать не рекомендуется, то вы гарантированно похудеете.

Если серьезно поработать над своим рационом и записаться в спортивный зал, то результат тоже не заставит себя ждать. Но, оставив прежнее питание и образ жизни, вы можете не надеяться, что станете моделью. Но ставить низкую оценку тоже не у всех поднимается рука. Сказывается хороший дизайн баночки, отсутствие побочных эффектов, а также открытость представителей компании к диалогу.

Вместо заключения

Подводя итоги, хочется сказать, что этот препарат не стал новинкой на рынке лекарственных средств для снижения веса. Красивая реклама, проведенные исследования, но результата практически и нет. Пока вы не измените свой рацион и образ жизни, фигура останется прежней.

Если вы сможете достигнуть какого-либо эффекта, то довольно быстро вернетесь к прежним размерам. А причина проста — вы потребляете больше энергии, чем тратите. Ее избыток «оседает» на боках и животе, становясь подкожной жировой прослойкой. Так организм создает себе запас на случай, если пищи станет меньше.

Форсколин

Форсколин (англ. Forskolin) – это биологически активный компонент растения Coleus forskohlii (Колеус форсколии). Входит в состав многих продуктов спортивного питания в качестве жиросжигателя. Применяется при лечении мужских сексуальных проблем, астме, гипертонии и других недугах.

Форсколин: растение

Форсколин является активным веществом растения Колеус форсоколии, которое произрастает на горных склонах Индии, Непала и Таиланда. Лекарственное растение семейства мяты вырастает до 70 см в высоту и имеет листья зеленого цвета. Листья бархатные на ощупь имеют зазубринки по краям. Декоративные сорта имеют яркую окраску листьев.

Интересно! В качестве комнатного цветка выращивают гибридный колеус, его еще называют цветной крапивой. На него никогда не садятся насекомые. Он неприхотлив, а насыщенный окрас листьев поднимает настроение его хозяевам.

Форсколин: корень

Большую часть препаратов делают из корней растения. Но наземная часть растения также богата полезными веществами, в том числе и форсколином.

Форсколин: состав

По своей структуре форсколин является дитерпеном. Корень колеуса форсоколии содержит:

  • бетулиновую кислоту;
  • альфа-цедрол;
  • бета-ситостерол;
  • диметилкриптояпнол;
  • 14-деоксиколеон;
  • альфа-америн.

Форсколин: полезные свойства

Форсколин активно используется в аюрведической медицине, так как обладает большим количеством целебных свойств. Основные полезные свойства:

  1. Способствует снижению лишнего веса.
  2. Активизирует работу кишечника, помогает усвоению витаминов и минералов.
  3. Обладает противовоспалительными качествами.
  4. Повышает выработку тестостерона.
  5. Действует как сосудорасширяющее средство.
  6. Тормозит развитие опухолей.
  7. Нормализует метаболизм.
  8. Восстанавливает нервные волокна.

Обладая антигистаминным действием, форсколин приносит пользу при лечении астмы.

Внимание! Уникальность форсколина состоит в том, что он активирует особенный механизм в организме под названием цАМФ (циклический аденозинмонофосфат), тем самым положительно влияя на различные системы организма. ЦАМФ является своего рода передатчиком импульсов в клетки.

Форсколин: применение

Увеличить картинку

Уникальные свойства корня колеуса нашли применение и в традиционной медицине. В качестве активного дополнения форсколин назначают в следующих случаях:

  1. При острых респираторных заболеваниях.
  2. При повышенном давлении.
  3. При проблемах со сном.
  4. При аллергических реакциях разной степени.
  5. При напряжении и мышечных спазмах.
  6. При болезнях глаз, в частности глаукоме.
  7. Для достижения более высоких результатов в процессе похудения.

Важно! Форсколин в составе косметических средств способствует хорошему и ровному загару, защищает от солнца.

Форсколин: для сосудов

Еще в древней Индии экстракт использовался для лечения сердечно-сосудистых заболеваний, он укрепляет стенки сосудов и обладает сосудорасширяющим действием.

Форсколин: для сердца

Добавка форсколин нормализует сердечный ритм, укрепляет сердечную мускулатуру, предупреждает аритмию. Препарат включают в комплексную терапию людям с сердечной недостаточностью. Лечение проводится под наблюдением врача. Укрепить иммунитет и нормализовать работу сердца поможет добавки 7-Кето и кора ивы белой.

Форсколин: для пищеварения

Растительный препарат форсколин нормализует все обменные процессы в организме, в том числе и в пищеварительной системе. Он способствует хорошей работе кишечника, более полному перевариванию пищи.

Форсколин: для артериального давления

Экстракт форсколина эффективно снижает высокое давление более, чем на 75%, расслабляя артериальные стенки. Таким же образом действуют добавки масло иланг-иланг и наттокиназа.

Форсколин: для почек

Ускоряя расщепление жировых отложений, форсколин помогает нормализовать работу почек, устраняет негативные факторы, мешающие их нормальному функционированию.

Форсколин: для легких

Форсколин оказывает тонизирующее действие на работу легких. Американские ученые из города Лангон подтвердили полезное действие экстракта при лечении астмы. Препарат стабилизирует клетки, которые высвобождают гистамин, в данном случае он действует как бронходилататор с антигистаминным эффектом.

Форсколин: для щитовидной железы

Форсколин стимулирует щитовидную железу на выработку необходимых гормонов, которые ускоряют сжигание жировых клеток.

Форсколин: для потенции

Увеличить картинку

В ходе изучения действия форсколина на организм, проводились исследования на мужчинах. Цель опыта была похудение, но результаты были положительные не только в этом. Мужчины, страдающие ожирением, принимали по 500 мг экстракта в течение 3 мес. В результате: повысился уровень тестостерона, увеличилась мышечная масса, уменьшился подкожный жир. При этом нормализовалась эректильная функция, отмечено повышение сексуальной активности. Также поддержать сексуальное здоровье помогут пищевые добавки витекс священный, мукуна жгучая и горянка.

Форсколин: для похудения

Исследования о влиянии форсколина на избавление от лишнего веса, еще ведутся. Но уже сейчас ученые считают, что, применяя препарат в течение 3 мес., у человека значительно меняется внешний вид в лучшую сторону, конкретно снижается процент жира в организме.

Нужно учесть, что сам экстракт не сжигает лишний жир. Препарат подавляет аппетит, снижает склонность к перееданию, ускоряет обменные процессы. Самое главное – он поддерживает дефицит калорий, который возникает при ограничении в еде и при возрастании физической активности. Без желания человека и без его решительных действий похудеть не поможет ни одна пищевая добавка. Растительный экстракт форсколин поможет ускорить процесс обретения красивой фигуры. Не только похудеть, но и очистить организм от токсинов и снизить холестерин помогут пижма и Гарциния камбоджийская.

Научный факт! В ходе экспериментов ученые выяснили, что форсколин не только ускоряет сжигание жира, но и препятствует его новому накоплению. После курса препарата человек меньше чувствует усталость и голод.

Форсколин: для бодибилдеров

Научные исследования показали, что влияние форсколина на повышение тестостерона вызывает также рост мышечной массы. Расширяя сосуды, препарат способствует поступлению в мышцы питательных веществ. Добавка   помогает приобрести под действием солнца красивый загар, культуристы часто используют этот эффект, чтобы выглядеть более презентабельно на выступлениях. Прием препарата способствует более быстрому восстановлению после тренировки.

Форсколин: капсулы, БАД

В корнях растения содержится всего 0,3 % форсколина, такая дозировка не даст ощутимой пользы организму, поэтому форсколин принимают в качестве пищевой добавки с экстрактом колеуса.

Увеличить картинку
  1. Фирма Nature’s Answer выпускает препарат «Forskohlii» (250 мг, 60 капсул) в удобной форме вегетарианских капсул. Препарат полностью растительного происхождения произведен из корней Колеуса форсколии, подходит для вегетарианского питания. Произведено в США, каждая банка проходит полный контроль качества.

Рекомендации по применению: принимать по 1 капсуле перед едой. При дополнительном приеме других медикаментов, нужно проконсультироваться с врачом.

Форсколин: экстракт

Увеличить картинку
  1. Препарат Форсколин — экстракт корня колеус форсколии «Forskolin, Coleus Forskohlii Extract» (100 мг, 60 капсул) производит компания Advance Physician Formulas, Inc. Эта пищевая добавка, разработанная доктором медицины Рэем Сахеляном, предназначена для помощи при похудении и клеточной поддержки.

Рекомендации по применению: принимать 2 капсулы утром до приема пищи.

Форсколин: в аптеке

Как правило, трудно найти форсколин в обычных аптеках даже таких крупных городов как Москва, в чистом виде. Производители часто включают его в состав с другими веществами, тем самым снижая необходимую концентрацию и сводя эффективность к минимуму. Поэтому перед покупкой нужно тщательно изучить инструкцию к препарату, и если доля форсколина менее 10%, то лучше воздержаться от покупки. Разумнее покупать пищевые добавки в интернет-магазинах, которые находятся территории страны производителя, так будет легче избежать подделки и получать скидки по промокоду айхерб на скидку по акциям. Ссылка на один из таких дается ниже.

Форсколин: инструкция

Перед тем как принимать форсколин нужно учитывать, что обмен веществ у всех разный, и что в молодом возрасте похудение происходит быстрее. Поэтому людям в пожилом возрасте лучше получить консультацию у врача перед использованием такой активной пищевой добавки.

Форсколин: как принимать

Ученые выявили, что оптимальная суточная доза форсколина 400-500 мг в сутки. Ее лучше разделить на два приема и принимать по 250 мг два раза в день до приема пищи. Передозировка не усилит эффект похудения, разумнее будет увеличить физическую активность. Можно принимать по 100 мг трижды в день, при условии, что в препарате содержится 10% форсколина.

Важно! Суточная норма пищевой добавки не должна превышать 1000 мг.

Форсколин: противопоказания

Применение добавки форсколина не рекомендуется женщинам в период беременности и кормления грудью, а также детям до 18 лет.

Ввиду того, что препарат увеличивает кислотность желудка, его применение нужно ограничить людям с гастритом и язвенной болезнью.

Пищевая добавка больше подойдет мужчинам, так как нормализует гормональный фон.

Форсколин: отзывы

Увеличить картинку

Форсколин не так давно появился на российском рынке, поэтому отзывы о препарате есть в основном на зарубежных форумах. Пользователи пишут, что форсколин реально запускает жиросжигание в организме. Пользователи проводили анализы на уровень тестостерона до и после приема колеуса. Результаты впечатляют: уровень свободного тестостерона поднялся в среднем на 12-18%. Препарат популярен среди спортсменов, так как помогает похудеть, нарастить мышцы и усилить загар.

Стоит отметить, что не у всех потребителей форсколин дает столь ярко выраженный эффект. Организм у всех разный и мнения о действенности добавки часто расходятся. В одном пользователи согласны: пищевая добавка хорошо переносится организмом, не причиняет вреда и не имеет побочных эффектов. Еще один плюс – начав ее принимать, люди начинают больше двигаться.

Форсколин: цена

Высокая цена сейчас не является показателем качества. Выбирая форсколин в российских интернет-магазинах, нужно обратить внимание на дозировку, производителя и сравнить цены в разных точках продаж. Если форсколин в препарате значится как один из очень многих составляющих, то есть ли смысл платить просто за название. Вот ссылка на одну из популярных интернет-аптек. Здесь строго следят за качеством, дозировкой основного вещества и хранением продукции. Зайдя на сайт, можно удостовериться, что цены в 2-5 раз ниже при проверенном качестве продукции. На сайте спортсмены найдут разнообразное спортивное питание: предтренировочный комплекс, ZMA, ацетил L-карнитин, казеин, BCAA и другие. Здесь представлены самая нужная продукция для здоровья, такие товары как: кедровое масло, бета-каротин, коэнзим Q10, омега-3 и женьшень.

Форсколин: купить

Вот такой большой ассортимент форм, дозировок и производителей форсколина:

1. Купить форсколин по низкой цене и с гарантированным высоким качеством можно в известном американском интернет-магазине органики iHerb, так полюбившемуся жителям России и СНГ (покупка в рублях, гривнах и т.д., отзывы на русском языке к каждой добавке).
2. Подробная пошаговая инструкция по оформлению заказа (очень простая): Как сделать заказ на iHerb!
3. При первом заказе, дается код iHerb и вам доступна !скидка $5 для новых покупателей и 5% для «старых»(без ДОП. СКИДОК), а также выгодные Акции до 60%! Рекомендуем обязательно воспользоваться, т.к. при втором заказе также можно рассчитывать на скидки или вернуть часть средств через надежные кэшбэк-сервисы, которые попробуют вернуть проценты с покупки на и без того невысокие цены! Обязательно посмотрите акции и распродажи в популярных интернет-магазинах, например, по купону Красотка Про вы получите хорошие скидки на косметику, а промокоды Эльдорадо помогут сэкономить на технике для дома!
4. Подробные статьи о тонкостях доставки и оплаты: iHerb оплата и iHerb доставка!

Источник фото: iHerb.com

Как вам помогает форсколин? Ваш отзыв или совет очень важен новичкам и людям, страдающим аналогичными недугами!

Форсколин (Forskolin) для похудения

Форсколин – это уникальный по всем параметрам средство, в основе которого присутствует экстракт растения, известного, как Coleus forskohlii.

 Его основное действие направлено на стремительное сокращение участков, на которых присутствует жировое отложение. Препарат дает возможность быстро и полностью избавиться от лишнего веса.

 Принимая данный препарат, можно на нагружать себя диетами и физическими занятиями. Достаточно просто начать принимать препарат и он тут же начнет работать на сжигание жира, буквально сжигая его.

 Стоит знать, что чем в более лучшей форме находится человек, тем более заметным будет общий эффект похудения. В качестве определенного приятного бонуса препарат в состоянии обеспечить привлекательное увеличение мышечной массы.

Преимущества:

Среди основных преимуществ препарата можно отметить такие важные факторы, как:

  1. Гарантия стремительного и качественного похудения.
  2. Ускоряется обмен веществ.
  3. Препарат не просто обеспечивает процесс похудения, но также препятствует накоплению жира в организме.
  4. Прием препарата дает возможность поддерживать в тонусе все мышцы.
  5. Обладает незначительным сосудосуживающим эффектом.
  6. Может помочь в процессе борьбы с опухолями.
  7. В составе присутствуют витамины группы В.

Прием данного средства для похудения способствует укреплению иммунитета, а также эффективно замедляет старение. Каждый из преимущественных факторов – это не пустые слова, преимущества были доказаны многочисленными клиническими исследованиями и тестированиями.

Применение:

Дозировки форсколина зависят от процесса стандартизации. Как правило, экстракт растения стандартизируется под 10% форсколина, таким образом, суточная дозировка форсколина составляет 100-200 мг и ни в коем случае не должна превышать 1000 мг.

 


Продукт не является лекарственным средством. Не является БАД. 
Все результаты сугубо индивидуальны и зависят от особенностей организма.

Форсколин, 400 мг, 60 капсул

Swanson™ Форсколин — Аюрведический Препарат, 400 мг.

Количество: 60 капсул.


«Употребляю этот препарат в течение 6 месяцев. И я вполне доволен результатами. Препарат обеспечивает необходимую поддержку и защиту, а также является достаточно эффективным, когда используется регулярно.» ~ Отзыв о препарате от Elena1.


Coleus, относится к семейству мяты, родина — Индия и Юго-Восточная Азия, имеет многовековую историю использования в индуистской и Ayruvedic фитотерапии. Традиционно используется для поддержания здоровья сердечно-сосудистой и дыхательной систем, а также и для других целей.

Swanson™ Форсколин является натуральным жиросжигателем, он помогает набрать сухую мышечную массу. Растение Форсколия использовалсь в индийской медицине с древних времён. Это растение является источником удивительных соединений, имеющих уникальное биологическое значение. В Coleus Forskohlii содержится активный компонент форсколин.

В наши дни форсколин можно обнаружить во многих популярных жиросжигателях, представленных на рынке, а все благодаря способности дитерпена-форсколина ускорять жировой обмен естественным путем. Кроме того, недавние исследования показали, что форсколин способствует увеличению продолжительность жизни и замедляет процессы старения за счет положительного влияния на артериальное давление, сердечную деятельность и дыхательную систему. Этот жиросжигатель обычно применяют мужчины, которые хотят обладать красивым торсом и накаченными бицепсами.

Было доказано, что при применении форсколина происходит увеличение производства гормонов щитовидной железы, а также стимулируется высвобождение гормона щитовидной железы. Как известно щитовидная железа отвечает за скорость обмена веществ, за счет гормонов, которые она выпускает. Таким образом, рост производительности щитовидной железы приводит к улучшению обмена веществ. 

Доказано, что форсколин повышает выработку тиреоидных гормонов и стимулирует секрецию гормонов щитовидной железы в кровоток. Как нам известно, тиреоидные гормоны отвечают за уровень основного обмена и интенсивность метаболических процессов. Поэтому увеличение продукции гормонов щитовидной железы приводит к ускорению метаболизма. 

Форсколин обладает множеством научно доказанных эффектов, самые главные из которых:

  • Форсколин способствует снижению жировой массы тела. 
  • Сосудорасширяющий эффект, который также полезен в бодибилдинге, так как за счет этого улучшается питание мышц.
  • Форсколин повышает устойчивость к действию ультрафиолетового излучения, делая загар более темным.
  • Подавляет инфекции мочеполовой системы. Может применяться в комбинации с антибиотиками.
  • Противоопухолевый эффект
  • Форсколин восстанавливает периферические нервные волокна.

Благодаря уникальной фармакологии, форсколин полезен в широком диапазоне клинических заболеваний.

В настоящее время доказано, что форсколин лучше всего подходит для лечения:
  • Астмы
  • Экземы
  • Псориаза
  • Гипертонии
  • Застойной сердечной недостаточности и стенокардии

Форсколин можно использовать как в одиночку, так и в сочетании с другими растительными препаратами или другими методиками лечения этих заболеваний.

Состав

Размер порции 1 капсула

  Количество в одной порции % Дневная Норма
Coleus forskohlii (корень) 400 mg *

  *Суточная доза не определена.

Другие ингредиенты:
Желатин (капсула) и стеарат магния.

Дозировка: 
Принимать по 1 капсуле 2 раза в день, запив стаканом воды.
 

Сделано в США 

Курс на повышение уровня тестостерона Тестофен + Форсколин

Курс на повышение уровня тестостерона Тестофен + Форсколин

Тестофен + Форсколин — комбинированный курс от компании WestPharm на основе натуральных растительных компонентов, разработанный для усиления продукции тестостерона. Безопасные и эффективные ингредиенты нормализуют естественный гормональный баланс, снижают уровень кортизола, повышают секрецию половых гормонов. Изменения в гормональном профиле восстанавливают сексуальную активность, усиливают либидо, создают оптимальные условия для достижения поставленных целей в фитнесе, бодибилдинге, силовом спорте.

Механизм действия

Форсколин — натуральная пищевая добавка, которую получают из растения Coleus forskolii. Действующими компонентами являются соединения из группы алкалоидов, которые выступают в роли модуляторов фермента аденилатциклаза. Повышение активности аденилатциклазы приводит к увеличению внутриклеточной концентрации цАМФ (циклический аденозинмонофосфат), что в свою очередь усиливает обмен веществ и ускоряет синтетические процессы.

Повышение метаболической активности проявляется форсированием липолиза (расщепление триглицеридов жировой ткани) и окисления жиров, увеличении синтеза и расхода энергии. В железистых тканях, в том числе в половых железах, интенсификация обменных процессов приводит к усиленной продукции гормонов. Результатом этих метаболических сдвигов становится повышение образования и секреции эндогенного тестостерона.

Тестофен — комбинированный тестостероновый бустер на основе натуральных компонентов. В состав бустера входят: экстракт пажитника (fenugreek), стандартизированный по фурастоноловым сапонинам (стимуляторы выработки тестостерона), D-аспарагиновая кислота, цинк, Гинкго Билоба, витамин Д3, Фадогия, экстракт Эврикомы.

Тестофен оказывает комплексное действие на активность эндокринных желез. Снижает уровень гормона стресса кортизола, который, как известно, находится в обратной связи с тестостероном — чем выше уровень кортизола, тем ниже концентрация тестостерона, и наоборот. Фурастоноловые сапонины усиливают синтез гонадотропных гормонов гипофиза и тестостерона. Тестостероновый бустер Тестофен — эффективный инструмент для усиления и поддержания естественной выработки половых гормонов.

Эффекты курса Тестофен + Форсколин

Комбинированный курс Тестофен + Форсколин способствует нормализации гормонального баланса при сниженной активности половых желез, а также повышает естественный уровень свободного и общего тестостерона при нормальных исходных значениях.

В свою очередь, увеличение продукции мужских половых гормонов способствует:

  • Усилению либидо, сексуальной активности;
  • Нормализации эректильной функции;
  • Улучшению общего самочувствия, усилению мотивации, повышению жизненных сил и энергии.

Применение курса для усиления выработки тестостерона положительно сказывается и на спортивных показателях. Нормализация гормонального баланса создает благоприятные условия для анаболических процессов. Ускоряется восстановление мышц после тренировок, стимулируются липолитические реакции. Усиливается синтез протеина, растет мышечная масса, улучшается выносливость и силовые показатели.

Применение курса Тестофен + Форсколин:

  • Восстановление продукции эндогенного тестостерона после стероидных курсов;
  • Повышение выработки половых гормонов во время работы на силу, мышечную массу;
  • Интенсификация обмена веществ во время похудения, сушки, детализации рельефа.

Курс Тестофен + Форсколин рекомендован всем мужчинам старше 30-35 лет, поскольку в этом возрасте уже наблюдается значительно инволюционное угнетение выработки половых гормонов. Возрастные изменения гормонального фона приводят к потере мотивации, повышенной утомляемости, снижению либидо, проблемам с эрекцией, ухудшению эмоционального фона, депрессии. Курс Тестофен + Форсколин поможет избежать подобных проблем, а если избежать не удалось — эффективно с ними бороться.

Преимущества курса Тестофен + Форсколин

Комбинированный курс от компании WestPharm содержит исключительно натуральные и безопасные компоненты. Прием пищевых добавок Форсколин и Тестофен не приведет к нежелательным сдвигам в гормональном профиле, не вызовет функциональной перегрузки половых желез.

Курс Форсколин и Тестофен можно с успехом использовать после стероидных протоколов как во время ПКТ, так и после завершения послекурсовой терапии. Сочетанное действие активных компонентов будет способствовать скорейшему восстановлению уровня тестостерона, а вместе с этим мужской силы, мотивации, бодрости духа и непоколебимой нацеленности на успех!

Как принимать Тестофен + Форсколин?

Рекомендуемая доза тестостеронового бустера Тестофен: 4 капсулы в сутки. Следует принимать 2 капсулы утром, после приема пищи и 2 капсулы вечером, после ужина.
Рекомендуемая доза тестостеронового бустера Форсколин: 2 капсулы в сутки. Следует принимать 1 капсулу утром, после приема пищи и 1 капсулу вечером, после ужина.

Для курса на 1 месяц потребуется:
Testofen / 60 капс по 500 мг — 2 банки
Forskolin / 60 кап по 250 мг — 1 банка

Противогрибковое средство для лечения диуреза? | Американское общество нефрологов

Статья Вукичевича et al. 1 в этом выпуске журнала Американского общества нефрологов сообщает о влиянии флуконазола на увеличение осмотического транспорта воды в собирательных протоках почек за счет независимого от аргинина вазопрессина (AVP) эффектов на перемещение воды аквапорина-2 (AQP2). каналы. Эта статья примечательна по нескольким причинам, в том числе ( 1 ), что препараты с AVP-независимым действием на транспорт воды являются потенциальными средствами лечения нефрогенного несахарного диабета (NDI), синдрома, для которого существует только субоптимальное лечение; ( 2 ), что описанные эффекты флуконазола обеспечивают дополнительную поддержку механизмов, которые, как полагают, лежат в основе убиквинирования AQP2 и его доставки в клетки собирающих протоков почек; и ( 3 ), что, возможно, наиболее важно, отчет иллюстрирует потенциал для перепрофилирования существующих препаратов, одобренных Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA), для новых показаний.Каждый из этих моментов заслуживает дальнейшего рассмотрения.

NDI возникает, когда основные клетки собирающего протока не могут ответить на AVP повышенной резорбцией воды в результате транслокации каналов AQP2 в апикальную мембрану клеток. Лечение врожденных и приобретенных NDI включает диуретики (тиазид и амилорид), которые увеличивают реабсорбцию растворенных веществ и воды в более проксимальных сегментах нефрона, диеты с низким содержанием растворенных веществ для уменьшения облигатной экскреции свободной воды и ингибиторы циклооксигеназы PG, которые усиливают действие AVP.Однако у многих пациентов эффективность этих методов лечения ограничена, и для достижения клинически значимого снижения диуреза требуется комбинированная терапия. Следовательно, терапия, увеличивающая водный транспорт независимо от AVP, может представлять собой заметное улучшение терапии пациентов с NDI. Возможные механизмы лечения NDI, вызванного мутациями AVPR2, включают фармакологические шапероны для частичной коррекции неправильной обработки мутантных клеток AVPR2 2 и препараты для обхода эффектов AVPR2 на основные клетки собирающего протока, включая ингибиторы рецепторов PG, β агонисты 3-адренорецепторов и агонисты рецепторов секретина. 3 Однако ни один из этих потенциальных методов лечения еще не нашел практического применения в клинической практике. Поэтому к любому новому кандидату терапии этого тяжелого расстройства, например к флуконазолу, следует относиться с осторожным энтузиазмом.

AVP-стимулированная передача сигнала ответственна за большинство AVP-индуцированных антидиуретических эффектов в почках, но потенциальная роль не-AVP модуляторов трафика AQP2, таких как PG E2, оксид азота и аденозин, остается менее очевидной.Хотя молекулярные пути, участвующие в AVP-опосредованной активации AVPR2, хорошо изучены, 4 молекулярные механизмы, участвующие в транспортировке AQP2 в апикальную мембрану собирающих протоков, а также в извлечении и интернализации каналов AQP2, все еще выясняются. Комплексные исследования in vitro , проведенные Vukicevic et al. 1 продемонстрировал повышенное содержание AQP2 в клетках IMCD, но отсутствие изменений в мРНК AQP2 указывало на то, что это не было связано с усиленной транскрипцией гена AQP2 .Скорее всего, комбинация клеточных эффектов, по-видимому, ответственна за повышенную осмотическую проницаемость, продуцируемую флуконазолом, включая ингибирование фосфорилирования AQP2 по S261, приводящее к снижению убихинирования, и ингибирование активности RhoA с уменьшением полимеризации F-актина, тем самым потенциально удаляя физический барьер для транспорта везикул AQP2 к апикальной плазматической мембране. Сходство этих результатов с результатами, полученными с помощью форсколина, усиливает важность этих эффектов для увеличения доставки AQP2 к плазматической мембране как важных модуляторов антидиуретических эффектов AVP. 5

Знание молекулярных основ заболеваний предоставило дополнительные возможности для воплощения результатов этих исследований в новых лекарствах. Однако открытие лекарств требует все больших усилий, денег и времени из-за множества требований, предъявляемых к процессу утверждения лекарств, чтобы гарантировать эффективность и безопасность одобренных лекарств. Было подсчитано, что требуется около 12 лет и 2,6 миллиарда долларов, чтобы найти соединение-кандидат и пройти все доклинические и клинические испытания, необходимые для утверждения FDA. 6 Более того, большинство лекарственных препаратов-кандидатов не получают одобрения FDA из-за непредвиденных побочных эффектов и токсичности. Следовательно, стратегии по сокращению времени, необходимого для утверждения лекарства, снижению связанных с этим затрат и повышению вероятности успеха, были бы полезными. Перепрофилирование лекарств — это стратегия, которая может достичь этих целей. 7 Агенты, уже одобренные FDA, были протестированы на людях, поэтому доступна подробная информация об их фармакологии, составе и токсичности.Если будут найдены новые показания для таких уже одобренных лекарств, новые подходящие методы лечения будут быстрее готовы к клиническим испытаниям, что ускорит их рассмотрение и возможное одобрение FDA для лечения различных заболеваний.

Уже было много примеров успешного перепрофилирования лекарств. Первые успешные случаи перепрофилирования лекарств стали результатом случайных открытий. Силденафил был протестирован в качестве средства для лечения эректильной дисфункции только после того, как усиление эрекции было обнаружено как побочный эффект в испытаниях 1 фазы препарата для лечения сердечно-сосудистых заболеваний.Антигипертензивный препарат миноксидил был изменен в крем для местного применения после того, как пациенты испытали отрастание волос в результате приема препарата. Более поздние открытия включают возможность использования онкологического препарата нилотиниб для лечения нейродегенеративных расстройств, таких как болезнь Паркинсона. 8 В настоящее время исследователи применяют более целенаправленные подходы к выявлению потенциальных новых применений для существующих и неудачных лекарств с использованием высокопроизводительных методов, таких как крупномасштабные клеточные экраны и стратегии биоинформатики для обнаружения потенциальных лекарств.В исследовании Vukicevic et al. 1 демонстрирует этот подход. Авторы проверили библиотеку из 17 700 малых молекул в клеточном анализе для выявления модуляторов локализации AQP2; Этот высокопроизводительный скрининг выявил противогрибковый препарат флуконазол в качестве потенциального кандидата. 9 Первым шагом в оценке потенциальных лекарств-кандидатов является проведение необходимых доклинических исследований in vitro, и in vivo , чтобы определить, оказывает ли лекарство желаемый биологический эффект: в этом случае повышается осмотический транспорт воды в собирательном канале почек. клетки.Исследования, представленные в этом выпуске, убедительно подтверждают антидиуретическое действие флуконазола, но только клинические испытания могут подтвердить его эффективность на людях. Общая неопределенность заключается в том, повторяют ли дозы, использованные в доклинических исследованиях in vitro, и in vivo , диапазон уровней в крови, полученных терапевтическими дозами перепрофилированного лекарственного средства. В связи с этим вызывает определенное беспокойство отсутствие сообщений о гипонатриемии при применении флуконазола, чего можно было бы ожидать от средства, оказывающего значительное антидиуретическое действие.Однако подтверждающие клинические испытания можно проводить быстро и более целенаправленно, поскольку это одобренный FDA препарат с известной токсичностью. Это приводит к возможности того, что более эффективное лечение НДИ может появиться в относительно короткий период времени.

Национальный центр развития трансляционной науки (NCATS) взял на себя ведущую роль в перепрофилировании лекарств с помощью различных программ. Группа перепрофилирования терапевтических средств для редких и забытых заболеваний сотрудничает с исследователями из Национальных институтов здравоохранения, университетов и других некоммерческих исследовательских институтов, а также с компаниями частного сектора, чтобы определить мишени для лекарств или фенотипы заболеваний для разработки анализов, а также разработать и оптимизировать анализы для высоких доз. проверка пропускной способности (https: // ncats.nih.gov/trnd). Подобные услуги доступны во многих из 58 академических медицинских центров США, получивших награды Clinical and Translational Science Awards (CTSA) от NCATS. Дополнительной важной услугой, предоставляемой центрами CTSA, является доступность подразделений клинических исследований для продвижения недавно идентифицированных перепрофилированных соединений для клинических испытаний для лечения редких и забытых заболеваний, поскольку перепрофилирование генерических лекарств для новых целей обычно не является приоритетом для фармацевтических компаний из-за ограниченные возможности финансовой окупаемости инвестиций.

Даже если клинические испытания на людях покажут значительный антидиуретический эффект терапевтических доз флуконазола, необходимо будет признать несколько ограничений. ( 1 ) NDI, вызванный мутациями AQP2, скорее всего, не отреагирует, потому что водопроницаемость AQP2 необходима для физиологической функции собирательных трубок и, следовательно, не может быть обойдена. ( 2 ) Величина антидиуретического эффекта, производимого агентами, которые влияют на трафик AQP2 без активации AVP2R, будет ограничена, потому что в отсутствие стимуляции AVP транскрипции гена AQP2 количество клеточного AQP2 снижается, тем самым уменьшая максимальный антидиурез. 10 ( 3 ) Известная токсичность агентов, таких как кетоконазол, может стать более проблематичной при длительном применении, которое будет необходимо для хронического лечения НДИ. Тем не менее, любое лечение, которое может улучшить полиурию и гиперосмоляльность NDI, будет представлять собой важный шаг вперед в терапии этого сложного расстройства.

Благодарности

Prof. J.G. Verbalis, является частным лицом Центра клинической и трансляционной науки Университета Джорджтауна-Ховарда, который получил награду за клиническую и трансляционную науку от Национального центра развития трансляционных наук Национального института здравоохранения под номерами наград UL1-TR001409, KL2. -TR001432 и TL1-TR001431.Автор несет полную ответственность за содержание и не обязательно отражает официальную точку зрения Национальных институтов здравоохранения.

Сноски

  • Опубликованы в Интернете перед печатью. Дата публикации доступна на сайте www.jasn.org.

  • См. Статью по теме «Флуконазол увеличивает перенос осмотической воды в собирательном канале почек за счет воздействия на передачу аквапорина-2» на страницах 795–810.

  • Авторские права © 2019 Американского общества нефрологов

Форсколин (Coleus forskohlii) — a utrata tkanki tłuszczowej

Coleus forskohlii -> Forskolin (pokrzywa indyjska)

Pokrzywa indyjska, zwana również pochwiatką, pokrzywką, szałwią indyjską LUB koleusem, czyli Колеус Forskohlii шуткой rośliną wieloletnią rosnącą ш rejonach subtropikalnego Ораз ciepłego, umiarkowanego klimatu niektórych obszarów Indii, Nepalu, Шри Lanki, Birmy, Tajlandii Ораз innych krajów Azji Południowo-Wschodniej.

Ekstrakt г korzenia pokrzywy indyjskiej stosowany BYL од stuleci ш tradycyjnej medycynie hinduskiej, ayurvedzie, яко Guggul делают leczenia nadciśnienia tętniczego, zastoinowej niewydolności Serca, wyprysków, колки, zaburzeń układu oddechowego, Przy bolesnym oddawaniu moczu (stanach zapalnych pęcherza moczowego), bezsenności, drgawkach, skurczach żołądka, zapobieganiu astmie, wzmacnianiu serca и całego organmu oraz jako środek ułatwiający odchudzanie. Również kuchnia indyjska w szerokim zakresie wykorzystywała Coleus jak doskonałą przyprawę.
Badania naukowe rozpoczęte na szeroką skalę w 1974 r. (Zwłaszcza ш Hinduskim Centralnym Instytucie Naukowo-Badawczym) wykazały, że о zdolnościach terapeutycznych rośliny decydują przede wszystkim zawarte ш нич związki diterpenowe — acetoxycoleosol, barbutazyna (barbatusin), coleol, coleonon, coleanol, deoxycoleonol, dialdehydy, krocetyna, napthopiron, plektryna, plektirinon , секоабиетан. Dopiero po dokładnej identityfikacji i wyodrębnieniu zasadniczej subsji czynnej nazwano ją forskolinem (forskoliną) — na cześć fińskiego botanika Petera Forskala (1736-1763).

Forskolin jest odpowiedzialny za prawie wszystkie działania farmakologiczne Coleus forskohlii.

Otóż w pierwszym rzędzie wpływa on na wzrost produkcji AC — энзиму zwanego cyklazą adenylową (adenylocyklazą), związanego z błonami komórkowymi. Шутка на rodzajem энзима nadrzędnego stymulującego inne энзимия do regulowania wzrostu masy mięśniowej oraz inicjowania processów utraty tłuszczu. Przekształca kwas adenozynotrójfosforowy (ATP) w cAMP — Cykliczny Monofosforan Adenozyny, który jest najważniejszym Regatorem organmu odpowiedzialnym za интенсивная информация rozpadzrwachłuszcówk.Związek ten zapewnia przyspieszony transport tłuszczu do komórek mięśniowych w celu jego spalenia.

Forskolin zwiększa produkcję cAMP, dochodzi do stymulacji syntezy białek, co wpływa na rozwój masy mięśniowej!
W wyniku dalszych processów następuje uwalnianie kwasów tłuszczowych z komórek tkanki tłuszczowej. W efekcie komórki mięśniowe mogą w łatwy sposób zużyć tłuszcz — zasadnicze w tym przypadku ródło energii — jako paliwo — i przekształcesses go w energię w postaci ATP.Celem tego processu jest wytworzenie ciepła z ATP dla utrzymania stałej temperatury ciała. Pozwala to na włączenie do processu spalania znacznych zapasów tłuszczu stanowiącego paliwo dla pracujących mięśni. Jest to szczególnie istotne zwłaszcza dla osób otyłych, które zwykle mają obniżony poziom CAMP.

Działanie terapeutyczne forskoliny oparte jest więc przede wszystkim o silną stymulację produkcji cAMP — Cyklicznego Monofosforanu Adenozyny we wszystkich komórkach organmu — oprówcz.

Funkcje CAMP (m.in.):
-Zwiększa przepuszczalność błon komórkowych
-Jest informatorem Другого rzędu pośredniczącym w działaniu wielu гормонув (Np: noradrenaliny, glukagonu):
-Jest kluczowym związkiem integrującym Regulację rozpadu i syntezy glikogenu.
-Zwiększa glikogenzę wątrobową i jest sygnałem głodu.
W przypadku niedoboru glukozy glukagon symuluje syntezę cAMP. Адреналина я глюкагон hamuj glikolizę и pobudzają glukogenzę wątrobie.Gdy zwiększa się ilość CAMP, zwiększa się glukogenza wątrobowa.
-Przyspiesza przemiany w cyklu kwasów trikarboksylowych, wzmaga utlenianie komórkowe i syntezę ATP.
-Wpływa na przemianę lipidów.
-hamuje synteze lipidów (tłuszczów) w komórkach tzw. tkanki tłuszczowej ółtej,
— silna redukcja tkanki tłuszczowej na skutek stymulacji processu rozkładu składników budulcowych tkanki tłuszczowej (liolizy) z jednoczesnym umiarkowanym rozwojajrozwojezrozwojez tkanki mi.beztłuszczowej masy ciała (szczególnie istotne dla uprawiających sporty wyczynowe),
— aktywowanie w komórkach tłuszczowychethermu lipazy гормонозалезней (HSL) w celu uwalniania tłuszczu zapasowego i jego transportu do miejsc wymagajcych zaopatrzenia w paliwniech, mi
— stymulacja wydzielanieormonów tarczycy,
— pobudzanie termogenzy — processu, którego celem jest wytworzenie ciepła z ATP dla utrzymania stałej temperatury ciała.

Forskolin wpływa również na działanie Germonów tarczycy (o czym wzmianka wyzej), dzięki czemu odznacza się funkcją Regującą метаболизм organmu.
Hormony tarczycowe wpływają w sposadniczy na przemianę materii oraz aktywność psychoomotoryczną, czyli na ogólną sprawność całego organmu. Im lepiej działa tarczyca, tym więcej tłuszczu można spalić и zamienić go na użyteczną energię.

Zarówno insulina jak i katecholaminy wpływaja na poziom cyklicznego AMP (CAMP) w komórkach tłuszczowych, który okresla jak bardzo aktywny jest HSL.
Gdy poziom CAMP jest niski, niski jest równiez poziom HSL и rozpad tłuszczy jest niski.Gdy poziom cAMP jset wysoki, wysoki jest poziom HSL oraz rozpad tłuszczy.
Insulina zmniejsza ilosc cAMP или катехоламин.
Im wyzszy poziom cAMP, tym wyzszy poziom HSL i wiecej zapasów tłuszczowych ulega uwolnieniu z komórek tłuszczowych. Wiec oczywiste jest, ze jezeli chcemy spalac tłuszcz — chcemy wysoki poziom cAMP.

-> Forskolin — активный лагерь

Форсколин: уникальный дитерпеновый активатор циклических систем, генерирующих АМФ.

Форсколин, дитерпен семейства лабданов, активирует аденилатциклазу в препаратах разрушенных клеток, а также в интактных тканях. Эта активация не требует регуляторной субъединицы гуанинового нуклеотида фермента и, вероятно, происходит через взаимодействие с каталитической субъединицей аденилатциклазы. Активация аденилатциклазы форсколином приводит к заметному увеличению уровней внутриклеточного циклического АМФ в различных эукариотических клетках. Низкие концентрации форсколина, которые сами по себе вызывают небольшое повышение внутриклеточного циклического АМФ, значительно усиливают гормональную активацию аденилатциклазы в ряде интактных клеток.Форсколин вызывает клеточные ответы, которые, как предполагалось, зависят от циклического АМФ в качестве вторичного мессенджера. Форсколин, таким образом, представляет собой бесценный инструмент для исследования роли циклического АМФ в физиологических реакциях на гормоны, как за счет прямой активации аденилатциклазы, так и за счет его способности потенцировать гормональную активацию аденилатциклазы.

http://www.ncbi.nlm.nih.gov/pubmed/6278005

форсколин активный лагерь

Активация систем, генерирующих циклический АМФ в мембранах и срезах головного мозга дитерпеновым форсколином: усиление опосредованных рецептором ответов.

Дитерпен форсколин заметно активирует аденилатциклазу в мембранах различных областей мозга крыс и вызывает заметное накопление радиоактивного циклического АМФ в меченных аденином срезах коры головного мозга, мозжечка, гиппокампа, полосатого тела, верхних колликулов, гипоталамуса, мозгового вещества, таламуса. понс. В срезах коры головного мозга форсколин оказывает полумаксимальное действие при 20-30 мкМ на уровни циклического АМФ как отдельно, так и в присутствии ингибитора фосфодиэстеразы ZK 62771.Присутствие очень низкой дозы форсколина (1 мкМ) может усилить реакцию систем мозга, генерирующих циклический АМФ, на норэпинефрин, изопротеренол, гистамин, серотонин, дофамин, аденозин, простагландин E2 и вазоактивный кишечный пептид. Форсколин не усиливает реакцию на комбинации гистамин-норадреналин, аденозин-норэпинефрин или гистамин-аденозин. Для норэпинефрина и изопротеренола в срезах коры головного мозга крысы и для гистамина в срезах коры головного мозга морских свинок присутствие 1 мкМ-форсколина увеличивает очевидную эффективность амина, тогда как для аденозина, простагландина E2 и вазоактивного кишечного пептида основной эффект 1 мкМ-форсколин предназначен для увеличения кажущейся активности стимулирующего агента.В срезах полосатого тела крысы форсколин выявляет значительную реакцию систем циклического АМФ на дофамин и усиливает вызванную дофамином активацию аденилатциклазы в мембранах полосатого тела крысы. Активация систем циклического АМФ форсколином является быстрой и обратимой и, по-видимому, включает как прямую активацию аденилатциклазы, так и облегчение и / или усиление опосредованной рецептором активации фермента.

http://www.ncbi.nlm.nih.gov/pubmed/6125572

Форсколин: уникальный дитерпеновый активатор аденилатциклазы в мембранах и в интактных клетках.

Дитерпен, форсколин [полумаксимальная эффективная концентрация (EC50), 5-10 мкМ] активирует аденилатциклазу [АТФ-пирофосфат-лиазу (циклизация), EC 4.6.1.1] в корковых мембранах головного мозга крыс быстрым и обратимым образом. . Активация не зависит от экзогенных гуаниловых нуклеотидов и не ингибируется гуанозин-5′-O- (2-тиодифосфатом) при анализе с аденозин-5′-β, гамма-имидо] трифосфатом в качестве субстрата. GTP и GDP усиливают реакцию на форсколин.Активация аденилатциклазы форсколином и гуанозин-5 ‘- [бета, гамма-имидо] трифосфатом p [NH] ppG не является аддитивной, тогда как активация форсколином и фторидом аддитивна или частично аддитивна. Ответы аденилатциклазы на форсколин или фторид не ингибируются ионами марганца, тогда как реакция на p [NH] ppG полностью блокируется. Активация аденилатциклазы форсколином значительно выше, чем активация фторидом в мембранах мозжечка, полосатого тела, сердца и печени крыс, и примерно равна или меньше активации фторидом в других тканях.Форсколин (ЕС50, 25 мкМ) вызывает быстрое и легко обратимое 35-кратное повышение циклического АМФ в срезах коры головного мозга крыс, которое не блокируется различными антагонистами нейромедиаторов. Низкие концентрации форсколина (1 мкМ) усиливают реакцию систем, генерирующих циклический АМФ в срезах мозга, на норэпинефрин, изопротеренол, гистамин, аденозин, простагландин E2 и вазоактивный кишечный пептид. Форсколин, по-видимому, активирует аденилатциклазу посредством уникального механизма, включающего как прямую активацию фермента, так и облегчение или усиление модуляции активности фермента рецепторами или субъединицей, связывающей гуаниловый нуклеотид, или и тем, и другим.

http://www.ncbi.nlm.nih.gov/pubmed/6267587

Форсколин как активатор накопления циклического АМФ и липолиза в адипоцитах крыс.

Форсколин увеличивал накопление циклического АМФ в изолированных адипоцитах и ​​заметно усиливал повышение уровня циклического АМФ за счет изопротеренола. В мембранах адипоцитов форсколин стимулировал активность аденилатциклазы при концентрациях 0,1 мкМ или выше. Форсколин не влиял на ЕС50 для активации аденилатциклазы, но усиливал максимальный эффект изопротеренола.Форсколин не влиял ни на растворимую, ни на активность низкокалорийной фосфодиэстеразы циклического АМФ с низким Km. Низкие концентрации форсколина (0,1–1,0 мкМ), которые значительно повышают уровни циклического АМФ, не увеличивают липолиз, тогда как аналогичное повышение уровней циклического АМФ из-за повышенного липолиза изопротеренола. Форсколин не ингибировал активацию триацилглицерин липазы циклической АМФ-зависимой протеинкиназой или последующий гидролиз триацилглицерина. Более высокие концентрации форсколина (10-100 мкМ) усиливали липолиз.Как увеличенное производство циклического АМФ, так и липолиз из-за форсколина ингибировались антилиполитическими средствами инсулином и N6- (фенилизопропил) аденозином. Гипотироидизм снижает способность форсколина стимулировать выработку циклического АМФ и липолиз. Эти результаты показывают, что форсколин увеличивает выработку циклического АМФ в адипоцитах за счет активации аденилатциклазы. Липолиз активируется форсколином, но при более высоких концентрациях общего циклического АМФ, чем катехоламинов.

http: // www.ncbi.nlm.nih.gov/pubmed/6289066

Фармакология и инотропный потенциал форсколина в сердце человека.

Мы оценили эффекты дитерпенового соединения форсколина на препаратах аденилатциклазы миокарда человека, изолированных трабекулах и сосочковых мышцах, полученных из сердечной недостаточности человека, и собаках с острым инструментарием. Форсколин был мощным, мощным активатором аденилатциклазы миокарда человека и давал максимальное количество эффектов, равное 4.В 82 (нормально функционирующий левый желудочек) и в 6,13 (неработающий левый желудочек) раза больше, чем изопротеренол. В отличие от изопротеренола, форсколин сохранял полную активность в препаратах мембран, полученных от сердечной недостаточности. В препаратах циклазы форсколин демонстрирует уникальные субстратные и кинетические свойства Mg2 +, которые можно отличить от агонистов, связанных с рецептором гормона, или фторид-иона. Стимулирующий аденилатциклазу эффект форсколина был синергетическим с изопротеренолом, по-видимому, из-за того, что локализация активации форсколина находится за пределами уровня гормонального агониста рецептора в комплексе рецептор-циклаза.Форсколин был мощным положительным инотропом при повреждении миокарда человека, вызывая стимуляцию сокращения, аналогичную изопротеренолу. Наконец, у собак с открытой грудью форсколин был положительным инотропным агентом, который уменьшал преднагрузку и постнагрузку. Мы пришли к выводу, что форсколин относится к классу агентов, которые могут иметь терапевтический потенциал при лечении застойной сердечной недостаточности.

http://www.jci.org/articles/view/111404

Изопротеренол — агониста рецепторов β-адренергического действия w miesniu sercowym zwieksza aktywnosc
cyklazy adenylanowej, prowadzac do nagromadzenia cAMP w kardiorniocytach.

Forskolin wykazal wzrost cyklazy adenylowej w sercu ludzkim 4,82x u zdrowego czlowieka a 6,13x przy niewydolności lewokomorowej.

-> Форсколин — утрата ваги.

Состав тела и гормональные адаптации, связанные с потреблением форсколина у мужчин с избыточным весом и ожирением.

Цель: в этом исследовании изучалось влияние форсколина на состав тела, уровень тестостерона, скорость метаболизма и артериальное давление у мужчин с избыточным весом и ожирением (ИМТ 26 кг / м2).

Методы и процедура исследования. Тридцать субъектов (форсколин, n = 15; плацебо, n = 15) были изучены в рандомизированном двойном слепом плацебо-контролируемом исследовании в течение 12 недель.

Результаты: было показано, что форсколин вызывает благоприятные изменения в составе тела за счет значительного снижения процентного содержания жира в организме (BF%) и массы жира (FM), как определено DXA, по сравнению с группой плацебо (p 0,05). Кроме того, введение форсколина привело к изменению костной массы в течение 12-недельного испытания по сравнению с группой плацебо (p 0.05). Наблюдалась тенденция к значительному увеличению безжировой массы тела в группе форсколина по сравнению с группой плацебо (p = 0,097).


Жировая масса.
После 12-недельного испытательного периода жировая масса значительно снизилась в группе форсколина (p 0,05) без изменений в группе плацебо. Кроме того, фактическое изменение жировой массы от «до» к «после» показало значительную разницу между группами (p 0.05;

LBM.
После 12-недельного испытательного периода LBM значительно увеличился в обеих группах (p 0,05). Никаких существенных различий между группами не было показано ни до, ни после временных точек. Однако фактическое изменение LBM от исходного уровня к окончательному показало тенденцию к значимости среди групп.

http://www.nature.com/oby/journal/v13/n8/full/oby2005162a.html

две группы:
-плацебо
-grupa przyjmująca forskolin w dawce 25mg forskolin 2xdzien (czyli 2 x 25mg) przez okres 12 tygodni

вниоски:

utrata tkanki tluszczowej
плацебо (предварительно / перорально)
35.65 / 35,14 кг (-0,51 кг; -1,73%)

форсколин (przed / po)
37,43 / 32,91 кг (-4,52 кг; -11,23%)

beztłuszczowa masa ciała:
плацебо (предварительно / перорально)
61,82 / 63,39 кг (+ 1,57 кг; + 2,56%)

форсколин (przed / po)
63,61 / 67,32 кг (+ 3,71 кг; + 5,65%)

suplementacja forskoliną skutkowale utarata tluszczu w ilosci 4,52 w porownaniu do плацебо 0,51 кг

Клинический отчет об использовании экстракта корня периллы (Coleus forskohlii) ForsLean® для уменьшения жировых отложений

250 мг форсколина = 25 мг форсколина

Дизайн и методология исследования
ForsLean® оценивали в ходе 12-недельного исследования в открытом поле на добровольцах с избыточной массой тела, 1 мужчине и 13 женщинах; средний вес 74.7 ± 11,98 кг, средний ИМТ 29,9 ± 4,31 и средний жир тела 38,2 ± 4,87%.

Форслин® вводили в дозе 125 мг 2 раза в сутки. Общая суточная доза ForsLean® была рассчитана как 25 мг дитерпен-форскохлина.

Каждый пациент был обследован в кабинете врача, и измерения состава тела проводились с помощью инфракрасного анализатора Futurex6200 в день 0, 1-й месяц, 2-й месяц и 3-й месяц.

Результаты исследования

Эффективность:
Общая масса тела имела тенденцию к снижению со средней 74.7 кг в начале исследования до 73,5 кг на 3-й месяц (p <0,05).

Индекс массы тела улучшился с исходного среднего значения 29,9 до 29,4 (p <0,05) по завершении исследования.

По окончании исследования количество жира в организме снизилось с начального среднего значения 38,2% до 37,1% (p <0,01).

Безжировая масса тела сохранялась в течение 12 недель приема ForsLean® (в среднем 45,8 кг против 45,9 кг).

Безопасность:
12-недельный режим приема 25 мг форскохлина в день существенно не изменил параметры артериального давления, т.е.е. среднее систолическое артериальное давление 135,7 мм рт. ст. против 128 мм рт. ст .; среднее диастолическое артериальное давление 85,3 мм рт. ст. против 83,6 мм рт. ст.

Заключение:

Это 12-недельное исследование ForsLean® в открытом поле на 14 японских испытуемых с избыточным весом показывает его полезность в управлении похуданием без явных субъективных и объективных побочных эффектов режима.

Асано Цугуёси (2001). Клинический отчет об использовании экстракта корня периллы (Coleus forskohlii) ForsLean® для уменьшения жировых отложений.Институт Асано. Токио, Япония .

14 ‘japonców’ (1mezczyzna + 13 kobiet) stosowalo 12,5mg forksolinu 2x dziennie (25mg) przez okres 12 tygodni

вики:
masa ciala (przed / po)
74,7 кг / 73,5 кг

wskaźnik masy ciała, BMI (przed / po)
29,9 / 29,4

tkanka tluszczowa (przed / po)
38,2% / 37,1%

Влияние добавок Coleus forskohlii на состав тела и показатели здоровья у малоподвижных женщин с избыточной массой тела


Форсколин 250 мг = 25 мг форсколина

Дизайн и методология исследования
Двойным слепым методом и случайным образом 23 женщины дополняли свой рацион ForsLean® (250 мг, n = 7) или плацебо (n = 12) два раза в день в течение 12 недель.

Состав тела (DEXA), масса тела и психометрические инструменты были получены на 0, 4, 8 и 12 неделях приема добавок.

Образцы крови натощак и записи о питании (4-е) были получены на 0 и 12 неделе. Побочные эффекты регистрировались еженедельно.

Результаты исследования

Эффективность:
Не наблюдалось значительных различий в потреблении калорий или макроэлементов.

ForsLean® имел тенденцию уменьшать прирост массы тела (-0.7 ± 1,8, 1,0 ± 2,5 кг, p = 0,10) и сканированной массы (-0,2 ± 1,3, 1,7 ± 2,9 кг, p = 0,08) без существенных различий в массе жира (-0,2 ± 0,7, 1,1 ± 2,3 кг, p = 0,16), масса без жира (-0,1 ± 1,3, 0,6 ± 1,2 кг, p = 0,21) или телесный жир (-0,2 ± 1,0, 0,4 ± 1,4%, p = 0,40).

Субъекты в группе ForsLean®, как правило, сообщали о меньшей утомляемости (p = 0,07), голоде (p = 0,02) и сытости (p = 0,04).

Безопасность:
Не было обнаружено клинически значимых взаимодействий в отношении метаболических маркеров, липидов крови, мышечных и печеночных ферментов, электролитов, эритроцитов, лейкоцитов, гормонов (инсулин, ТТГ, Т3 и Т4), частоты сердечных сокращений, артериального давления или еженедельных отчетов о побочных эффектах. последствия.

Заключение:

Результаты показывают, что ForsLean® может помочь уменьшить прибавку в весе у женщин с избыточным весом без очевидных клинически значимых побочных эффектов.

Kreider RB, et al. Влияние добавок Coleus forskohlii на состав тела и показатели здоровья у малоподвижных женщин с избыточным весом. Экспериментальная биология, запоздалые рефераты 2002 г. LB305: 2002.

23 kobiety podzielono na dwie grupy:
-плацебо
-grupe przyjumującą forskolin w ilosci 25mg x 2 (50mg ed) przez okres 12 tygodni

вики:
masa ciała (форсколин / плацебо)
-0.7 / + 1.0

tkanka tluszczowa (форсколин / плацебо)
-0,2 / + 1,1

beztluszczowa masa ciała (форсколин / плацебо)
-0,1 / + 0,6

poziom tkanki tluszczowej (форсколин / плацебо)
-0,2 / + 0,4

Рандомизированное двойное слепое плацебо-контролируемое исследование (Индия)

Дизайн и методология исследования
Двенадцатинедельное двойное слепое рандомизированное исследование с участием 60 мужчин и женщин-добровольцев с ожирением в возрасте от 25 до 45 лет с индексом массы тела (ИМТ) от 28 до 40 и / или концентрацией жира выше 30% у мужчин и 40% у мужчин. самки

Субъекты получали либо 25 мг дитерпен форскохлина два раза в день в форме ForsLean®, либо соответствующее плацебо.

Измерение массы тела и общего жира в организме на 0 неделе, 3 неделе, 6 неделе, 9 неделе и 12 неделе.
Были проведены функциональные тесты щитовидной железы, оценивающие уровни гормонов Т3, Т4 и ТТГ до и после завершения исследования.
Липидные профили крови были получены первоначально и в конце 12 недель.
Функциональные пробы печени и почек первоначально по истечении 12 недель
Уровень глюкозы в крови и инсулин первоначально по истечении 12 недель
Гематологические параметры первоначально по истечении 12 недель

Результаты исследования

Эффективность:
добровольцев, получавших Forslean®, теряли в среднем 1.73 кг от их массы тела, в группе сравнения плацебо прибавили 0,25 кг. Эти различия статистически значимы.

За 12 недель лечения добровольцы, получавшие плацебо, набрали 0,68% жира. С другой стороны, группа, получавшая Forslean®, потеряла 0,46% жира. Эти различия статистически значимы.

В группе добровольцев, получавших Forslean®, наблюдалось увеличение LBM по сравнению с группой плацебо, где наблюдалось снижение LBM.Эти различия статистически значимы.

Холестерин ЛПВП показал статистически значимое увеличение у добровольцев, получавших Forslean®. Другие липидные профили сыворотки оставались статистически неизменными в группах, получавших Forslean® и плацебо.

Безопасность:
Было замечено, что уровни всех трех гормонов щитовидной железы оставались в пределах нормального диапазона как в группах, получавших активное соединение, так и в группах, получавших плацебо, после 12 недель режима.

У добровольцев, получавших активное соединение, к концу исследования наблюдалось значительное повышение сывороточных концентраций ЛПВП, в то время как уровни триглицеридов, общего холестерина, ЛПНП и ЛПОНП остались неизменными в этой группе по сравнению с исходным уровнем и уровнем группы плацебо.

Не было значительных изменений диастолического и систолического артериального давления у добровольцев, получавших Forslean® и плацебо.

Уровни глюкозы в крови и инсулина остаются неизменными в группах, получавших Форслин® и Плацебо.

Функциональный тест печени и почек и гематологические параметры не показали каких-либо изменений в группе добровольцев, получавших Forslean® и плацебо.

Заключение:

Результаты показывают, что ForsLean® снижает массу тела и жировые отложения, а также способствует увеличению безжировой массы тела.12-недельное лечение не вызывало каких-либо субъективных или объективных побочных эффектов ни в группах, принимавших активное соединение, ни в группах плацебо. В активной группе наблюдалось повышение уровня ЛПВП в сыворотке и значительное снижение отношения общий холестерин / ЛПВП по сравнению с контрольной группой. Не наблюдалось нежелательных эффектов на гормоны щитовидной железы, липидный профиль крови и другие параметры.

Исследование проведено в Исследовательском центре химии и биологических наук им. К. Б. Пателя, Мумбаи.
Данные из архива Sami Labs Limited, Бангалор, Индия.

60особ подзелона на две группы:
-плацебо
-grupe przyjmującą 25mg forskolinu 2x dzien (50mg ed) przed okres 12 tygodni

вики:
masa ciała (форсколин / плацебо)
-1,73 / + 0,25 кг

poziom tkanki tłuszczowej (форсколин / плацебо)
-0,46% / + 0,68%

-ponatdto zanowtowanu u grupy przyjmującej forskolin zpadek poziomu cholesterolu i poprawienie ratio hdl: ldl

Эффективность и безопасность ForsLean® в увеличении сухой массы тела у субъектов с ожирением

12-недельное рандомизированное двойное слепое плацебо-контролируемое исследование с участием 50 мужчин и женщин с ожирением показало, что субъекты, получавшие ForsLean, имели статистически значимое увеличение безжировой массы тела на 1.78 процентов по сравнению со снижением на 0,20 процента в группе плацебо. Кроме того, средний процент телесного жира в группе ForsLean показал статистически значимое снижение с 35,8 до 34,0 процента, в то время как в группе плацебо показатель увеличился с 38,8 до 39,0 процента. И после курса исследования средний индекс массы тела для группы ForsLean показал статистически значимое снижение с 30,3 до 28,6 после предварительного лечения через 12 недель, а в группе плацебо — с 33.1 до 32,7, изменение не было статистически значимым.

http://www.npicenter.com/article/Research/ForsLean-Increases-Lean-Body-Mass-and-Reduces-Body-Fat-Percentages-According-to-Recent-Study.aspx

50особ подзелоно на 2 группы:
-плацебо
-grupe przyjmującą 25 мг форсколину (25 мг ред) przez okres 12tygodni

вики:

beztluszczowa masa ciała (форсколин / плацебо)
+1,78% / — 0,20%

poziom tkanki tluszczowej forskolin (przed / po):
35.8 / 34,0% (-1,8%)

poziom tkanki tluszczowej плацебо (przed / po)
38,8 / 39,0% (+ 0,2%)

BMI (форсколин цена / по):
30,3 / 28,6% (-1,7%)

ИМТ плацебо (przed / po)
33,1 / 32,7% (-0,4%)

-> ciekawostka: Форсколин — тестостерон.

Состав тела и гормональные адаптации, связанные с потреблением форсколина у мужчин с избыточным весом и ожирением.

ЦЕЛЬ: В этом исследовании изучалось влияние форсколина на состав тела, уровень тестостерона, скорость метаболизма и артериальное давление у мужчин с избыточным весом и ожирением (ИМТ> или = 26 кг / м (2)).

МЕТОДЫ И ПРОЦЕДУРА ИССЛЕДОВАНИЯ. Тридцать субъектов (форсколин, n = 15; плацебо, n = 15) были изучены в рандомизированном двойном слепом плацебо-контролируемом исследовании в течение 12 недель.

РЕЗУЛЬТАТЫ: Уровни свободного тестостерона в сыворотке крови были значительно увеличены в группе форсколина по сравнению с группой плацебо (p <или = 0.05). Фактическое изменение концентрации общего тестостерона в сыворотке существенно не различалось между группами, но оно увеличилось на 16,77 +/- 33,77% в группе форсколина по сравнению со снижением на 1,08 +/- 18,35% в группе плацебо.

http://www.ncbi.nlm.nih.gov/pubmed/16129715

две группы:
-плацебо
-grupa przyjmująca forskolin w dawce 25mg forskolin 2xdzien (czyli 2 x 25mg) przez okres 12 tygodni

poziom calkowitego testosteronu (нг / мл):
форсколин цена / по:
5.06 / 5,75 (+0,69; + 16,77%)

плацебо цена / перорально:
4,12 / 4,00 (-0,11; -1,08%)

положительный уровень тестостерона (пг / мл):
форсколин цена / по:
15,90 / 16,36 (+0,46; + 3,47%)

плацебо цена / перорально:
13,28 / 12,77 (-0,51; -4,11%)

czesc informacji zaczerpnietych z:
http://pl.wikipedia.org/wiki/CAMP
http://www.antylicho.pl/forskolin.html

Zmieniony przez — solaros w dniu 2011-03-09 04:36:57

Frontiers | Путь циклического АМФ подавляет аутоиммунное нейровоспаление путем ингибирования функций энцефалитогенных Т-лимфоцитов CD4 и усиления поляризации макрофагов M2 в месте воспаления

Введение

Известно, что различные пути влияют на дифференцировку и функцию CD4 Т-клеток in vivo во время воспаления, связанного с аутоиммунитетом или инфекцией.Одним из наиболее распространенных и важных путей в этом процессе является путь цАМФ, который, как известно, участвует в негативной регуляции активации и пролиферации Т-клеток (1). Однако более подробные и недавние исследования показали, что цАМФ-индуцирующие агенты Cholera Toxin , 8-бром-цАМФ и одобренный FDA препарат Форсколин ингибируют пролиферацию Th2, но не Th3 эффекторных клеток in vitro (2). Кроме того, было показано, что Cholera Toxin -индуцированная экспансия, а не ингибирование клеток Th27 in vivo (3). Токсин коклюша , который был специально использован для активной индукции аутоиммунного воспаления центральной нервной системы (ЦНС), также активировал аденилатциклазу, что приводило к увеличению цАМФ (4). Однако токсин коклюша скорее стимулировал, чем подавлял рост Th2-клеток in vivo , что приводило к развитию аутоиммунного воспаления ЦНС (5). Более того, избирательное ингибирование пути цАМФ in vivo в Т-лимфоцитах CD4 продемонстрировало, что цАМФ необходим для дифференцировки и пролиферации клеток Th2 и Th27, но не Th3 и Treg (6).Таким образом, точная роль пути цАМФ в модуляции функции эффекторных Т-клеток во время аутоиммунного воспаления ЦНС остается неясной. Важным фактором, который может повлиять на функции Т-лимфоцитов в тканях во время воспаления, являются резидентные в тканях и полученные из крови макрофаги, которые рекрутируются в очаги воспаления и могут также подвергаться воздействию агентов, индуцирующих цАМФ.

Во время воспаления макрофаги активируются под влиянием цитокинов или патогенов, происходящих из Т-клеток, что приводит к двум или более различным (поляризованным) состояниям.Поляризация макрофагов в сторону классического фенотипа M1 индуцируется цитокинами Th2, такими как IFNγ, а альтернативный фенотип M2, индуцируемый цитокинами Th3, такими как IL-4, играет важную роль в регуляции функций Т-клеток во время инфекции и аутоиммунных заболеваний (7). Недавно было высказано предположение, что макрофаги не образуют стабильные популяции, а скорее имеют различные фенотипы в ответ на различные воспалительные стимулы (например, IFNγ по сравнению с IL-4) и часто образуют смешанные фенотипы (7, 8), что непредсказуемо влияет на функции Т-клеток в очаге воспаления, где макрофаги служат антигенпрезентирующими клетками.В нормальных условиях ЦНС имеет специфическое микроокружение, в котором резидентные макрофаги ЦНС (также называемые микроглией) обладают внутренним M2-подобным фенотипом и экспрессируют количество маркеров M2 (например, Ym1 и IL-4) и специфических микроРНК (miR) (например, , miR-124), которые способствуют поляризации M2 (9–11). Более того, ЦНС имеет внутренний источник ИЛ-4, который играет решающую роль в подавлении нейровоспаления, такого как экспериментальный аутоиммунный энцефалит (ЭАЭ) (9). Макрофаги M2 в нормальной ЦНС экспрессируют низкий уровень MHC класса II и CD86 и не стимулируют Т-клетки эффективно.

Подобно заболеванию человека рассеянному склерозу (РС), EAE представляет собой воспалительное заболевание ЦНС, которое инициируется аутоиммунными клетками Th2 и Th27, которые распознают аутоантиген в миелиновой оболочке [например, гликопротеин олигодендроцитов миелина (MOG)] (12). Клетки Th2 и Th27 продуцируют ряд цитокинов, таких как IFNγ, TNF и GM-CSF, которые опосредуют поляризацию M1 макрофагов, которые составляют ~ 70% воспалительных поражений ЦНС, и опосредуют большую часть повреждения нейрональной ткани путем производства TNF, оксида азота (NO ), и т.д.(7, 12–15). Поскольку ЦНС имеет внутреннее микроокружение с искажением M2, макрофаги в ЦНС во время EAE и других патологий часто проявляют смешанный фенотип M1 / ​​M2 под влиянием IL-4, производного от ЦНС, и IFNγ, производного от Th2 (16). Ранее мы обнаружили, что во время EAE макрофаги проявляют дважды активированный фенотип, одновременно экспрессируя маркеры M1 и M2, такие как CD86 и Ym1 (9). Эти результаты не были неожиданными, поскольку во время EAE цитокины M1 (IFNγ) и M2 (IL-4) присутствовали в воспаленной ЦНС.Следовательно, важно найти новые пути и кофакторы, которые могут искажать поляризацию макрофагов в сторону M2 в смешанных воспалительных состояниях во время EAE.

Одним из кофакторов, которые способствуют смещению макрофагов в сторону фенотипа M2 в ЦНС, является miR-124 (10). miRs представляют собой класс коротких (20–22 нуклеотидов) некодирующих РНК, которые регулируют многие физиологические процессы, включая поляризацию макрофагов (11). Ранее мы показали, что miR-124 экспрессируется в микроглии нормальной ЦНС, внося вклад в фенотип M2 микроглиальных клеток в состоянии покоя (10).Во время EAE экспрессия miR-124 в активированной микроглии была снижена, в то время как трансфекция макрофагов с помощью активируемых miR-124 маркеров M2, таких как аргиназа (Arg) 1 и рецептор маннозы C-типа 1 (Mrc1), и маркеров M1 с пониженной регуляцией, таких как CD86, синтетаза оксида азота (NOS) 2 и TNF, ведущие к выздоровлению от болезни (10). Мы также обнаружили, что miR-124 активируется в макрофагах, происходящих из костного мозга (BM), и перитонеальных макрофагах в ответ на IL-4, но влияние IL-4 на активацию miR-124 было умеренным (17).Более того, экспрессия miR-124 в микроглии в нормальной ЦНС была независимой от IL-4 / IL-13, тогда как предварительно обработанные IFNγ макрофаги M1 не смогли активировать miR-124 в ответ на последующую обработку IL-4 (17). Эти данные указывают на важность других путей, которые могут стимулировать miR-124 и изменять баланс в сторону M2 в ЦНС во время воспаления.

Форсколин (колеонол) происходит из индийского растения колеус и в настоящее время используется в качестве пищевой добавки или в качестве лекарственного средства для традиционной восточной медицины и противоопухолевой терапии (18).Мы обнаружили, что введение форсколина во время EAE ингибировало пролиферацию и продукцию IFN-γ Т-клетками CD4 в ЦНС и увеличивало количество M2-ассоциированных молекул miR-124, Arg1, Mrc1, Ym1 и Fizz1 и подавляло M1-ассоциированные молекулы MHC. класс II, CD86 и NOS2. Это указывает на очень сильное влияние этого препарата на модуляцию аутоиммунных CD4 Т-клеток и активацию / поляризацию макрофагов в месте воспаления ткани. Чтобы понять механизмы, мы искали пути, которые ингибируют патогенные Т-клетки CD4, усиливают действие IL-4 в поляризации M2 и повышают регуляцию miR-124 во время аутоиммунного воспаления ЦНС.Мы обнаружили, что форсколин не влияет напрямую на CD4 Т-клетки, но способствует M2-поляризации макрофагов. Дальнейший анализ показал, что форсколин и / или IL-4 активируют cAMP-чувствительный элемент, связывающий / активирующий фактор транскрипции (CREB / ATF), белки семейства, которые вносят вклад в повышающую регуляцию поляризации miR-124 и M2.

Материалы и методы

Мыши

мышей C57BL / 6 были первоначально приобретены в лаборатории Джексона и выращены на местном уровне в Центре обслуживания лабораторных животных Китайского университета Гонконга.Все процедуры с животными проводились по индивидуальной лицензии правительства Гонконга и одобрены комитетом по этике животных Китайского университета Гонконга.

Ячейки

Макрофаги, полученные из костного мозга, выращивали в среде DMEM (Gibco) с добавлением 10% FBS (Gibco) и M-CSF (R&D; 10 нг / мл) в течение 5 дней, как описано (10), и использовали для анализа. Перитонеальные макрофаги выделяли с помощью перитонеального лаважа и удаления неприлипших клеток через 14–16 ч инкубации в инкубаторе CO 2 (9).Анализ проточной цитометрии показал 96–98% клеток CD11b + F4 / 80 + в случае макрофагов, происходящих из BM и перитонеальных макрофагов. Для поляризации макрофагов клетки обрабатывали IL-4 (50 нг / мл), IFNγ (100 нг / мл) и / или форсколином (30 мкМ; Sigma) в течение указанных периодов времени от 2 до 24 часов. Оптимальная дозировка форсколина была определена после построения кривой доза-ответ (1–100 мкМ) для активации miR-124. Ингибитор ERK1 / 2 U0126 был приобретен у Cell Signaling, а другой ингибитор ERK1 / 2 PD184352 был приобретен у Abcam.Ингибиторы U0126 и PD184352 использовали в концентрациях 10 мкМ и 200 нМ, соответственно, в соответствии с рекомендациями производителя. Тауролидин (Sigma) использовали в дозе 100 мкМ. Ингибитор X5050 использовали в конечной концентрации 100 мкМ. Ингибирующую NRSE дцРНК использовали в концентрации 20 нМ, как описано (19). Первичные культуры корковых нейронов мышей проводили, как описано ранее (10).

EAE индукционный

ЕАЕ

индуцировали подкожной иммунизацией 150 мкг MOG 35–55 (американский пептид) в 4 мг / мл CFA (Diffco), как описано ранее (10).Токсин коклюша (Sigma) вводили внутрибрюшинно. (150 нг / мышь) в день 0 и день 2 после иммунизации. Отдельных животных ежедневно оценивали на предмет симптомов ЕАЕ и оценивали по шкале от 0 до 5 следующим образом: 0 — отсутствие болезни; 0,5, слабый хвост или легкая атаксия задних конечностей; 1, вялый хвост и / или атаксия задних конечностей; 2 — парез задних конечностей; 3 — паралич задних конечностей; 4 — паралич задних и передних конечностей; 5, смерть. Форсколин (3 мг / кг) или носитель (PBS с 1% ДМСО) вводили внутрибрюшинно. ежедневно от начала заболевания (14-е сутки) до пика заболевания (21–22-е сутки).Оптимальная дозировка форсколина для введения in vivo была выбрана путем снижения дозировки, о которой сообщалось, до 4–5 мг / кг в ранее опубликованном исследовании противоопухолевой терапии на модели мыши (20).

ПЦР в реальном времени

Для количественного определения различных маркеров и молекул с помощью ОТ ПЦР в реальном времени суммарную РНК выделяли с помощью наборов Qiagene или MirVana (Applied Biosystem) из культивируемых макрофагов, полученных из костного мозга или перитонеальных макрофагов, или из спинного мозга перфузированных PBS необработанных мышей или мышей на 22-й день после ЕАЕ.Для анализа экспрессии miRNA были выполнены RT-PCR в реальном времени с использованием тестов TaqMan miRNA для miR-124 (Applied Biosystems), а относительные выражения были рассчитаны с использованием метода Δ C T и нормализованы до равномерно экспрессируемой snoRNA55 (Applied Biosystems), как описано ранее (10, 21). Для анализа экспрессии мРНК для NOS2 (прямой праймер, 5′-ACCCACATCTGGCAGAATGAG-3 ‘; обратный праймер, 5′-AGCCATGACCTTTCGCATTAG-3′), Arg1 (прямой праймер, 5’-CTTGGCTTGCTTCGGAACTC-3 ‘; обратный праймер, 5’- GGAGAAGGCGTTTGCTTAGTTC-3 ‘) и Fizz1 (прямой праймер, 5′-GCCAGGTCCTGGAACCTTTC-3′; обратный праймер, 5’-GGAGCAGGGAGATGCAGATGAG-3 ‘), ATF3, прямой 5T-AGCATTCACACGTCCAG-3’ -GCATTCACACTCAGTCCAG-3 ‘-GCATTCACACTCAGTCCAG-3, прямой 5T-AGCATTCACACTCAGTCCAG-3’ -GCATTCACACTCAGTCCAG-3 ‘-GCATTCACACTCAGTCCAGAG-3’ -GCATTCACACTCAGTCCAG-3 ‘ , IL-1β, прямой 5’-CTTCCAGGATGAGGACATGAGCAC-3 ‘, обратный 5′-TCATCATCCCATGAGTCACAGAGG-3′, IL-6, прямой, 5’-CCTTCTTGGGACTGATGCTGGTG-3 ‘, TNF, прямой 5′-CTGT AGCCGATGGGTGTGTAGTAG, 5’-CTGT AGCCGATGGGTGTAGTAG, обратный ‘, Mrc1 прямой 5′-ACCACGGATGACCTGTGCTC-3′ обратный 5’-TGGTTCCACACCAGAGCCATC-3 ‘, CCDN1 прямой 5′-GCAGACCATCCGCAAGCATG-3′, обратный 5′-TGGAGGGTGGGTTGGAAATGAAC-фактор транскрипции сплайсинг) прямой 5’-CGACACATGCGGACTCATTC-3 ‘, обратный 5′-GCATGTCGGGTCACTTCATG-3′; Ym1, прямой 5’-CCATTGGAGGATGGAAGTTTG-3 ‘, обратный 5′-GACCCAGGGTACTGCCAGTC-3’, относительные выражения были рассчитаны с использованием метода Δ C T и нормализованы для гена домашнего хозяйства GADPH (прямой праймер, 5′-ATGACCACAGTCC ‘; Обратный праймер, 5′-GAGCTTCCCGTTCAGCTCTG-3’), а затем рассчитывали относительный уровень экспрессии по сравнению с контрольными условиями, как мы делали ранее (10).

Вестерн-блоттинг

Вестерн-блоттинг-анализ выполняли в соответствии со стандартным протоколом, как мы сообщали ранее (10). Антитела к ERK, фосфо-ERK, CEBP, фосфо-CEBP, CREB, фосфо-CREB, REST и β-актину были приобретены у Cell Signaling.

Проточная цитометрия

Мононуклеарные клетки были выделены из ЦНС или селезенки мышей с EAE на 22 день с использованием градиентов Перколла, как описано в наших предыдущих исследованиях (13, 21). Для анализа популяций микроглии, макрофагов и лимфоцитов и статуса активации макрофагов / микроглии клетки окрашивали анти-CD11b-AF480, анти-CD86-PE, анти-MHC класса II-PE-Cy5 (все из BD Bioscience), и F4 / 80-APC (eBiosceince) или анти-CD45-APC-Cy7 (BioLegend).FcR блокировали с помощью mAb, специфичного для FcR мыши (2.4G2; BD Biosciences). CD4 Т-клетки окрашивали для анализа поверхностных маркеров анти-CD4-APC, или анти-CD4-APC и анти-TCRβ-PE, или анти-CD4-APC и анти-TCR-Vβ 11 -PE (все из BD Biosciences). Эти данные были получены на цитометре LSR Fortessa (BD Biosciences) и проанализированы с использованием программного обеспечения FlowJo (TreeStar Inc.). Абсолютное количество клеток рассчитывали путем подсчета общего количества мононуклеарных клеток с помощью гемоцитометра и умножения на процентное содержание конкретных популяций, полученное с помощью проточной цитометрии.

Анализ пролиферации Т-клеток и макрофагов

Анализ включения

BrdU был использован для оценки пролиферации макрофагов, происходящих из BM, или CD4 T-клеток in vitro или in vivo , аналогично тому, как это было описано в наших более ранних исследованиях (12). Для выполнения этого анализа мы использовали набор BrdU от BD Biosciences, следуя инструкциям производителя. BrdU вводили внутрибрюшинно (2 мг / мышь) или добавляли к культурам в конечной концентрации 10 мкМ за 14 ч до анализа. Макрофаги окрашивали на маркеры клеточной поверхности CD11b, F4 / 80 и на внутриклеточный BrdU-FITC (BD Biosciences) и CD11b + F4 / 80 + gated и анализировали на включение BrdU с помощью трехцветной проточной цитометрии.CD4 Т-клетки окрашивали только на маркеры клеточной поверхности CD4 или CD4 и TCR-Vβ 11 и внутриклеточный BrdU и анализировали с помощью двух- или трехцветной проточной цитометрии.

Продукция цитокинов CD4 Т-клетками

Для внутриклеточного определения экспрессии IFNγ, ex vivo изолированные или культивированные мононуклеарные клетки ЦНС или селезенки были активированы ацетатом форболмиристата (50 нг / мл) и иономицином (1 мкг / мл; оба от Sigma) в присутствии GolgiStop ( 1 мкл / мл, BD Biosciences) в течение 4 ч.Клетки промывали, немедленно окрашивали на поверхностный маркер анти-CD4-APC, фиксировали / пермеабилизировали с использованием набора для определения внутриклеточных цитокинов BD и дополнительно окрашивали на внутриклеточный IFNγ с использованием анти-IFNγ-PE (все реагенты были приобретены у BD Biosciences). Клетки, закрытые CD4 + , анализировали с помощью двухцветной проточной цитометрии.

Ответ Т-клеточного отзыва

Для ответа на отзыв Т-лимфоцитов CD4 мышей иммунизировали 150 мкг MOG 35–55 (американский пептид) в 4 мг / мл CFA (Diffco), как описано ранее (10, 22).На 7-й день после иммунизации CD4-Т-клетки выделяли из дренирующих лимфатических узлов и селезенки с использованием отрицательной селекции и магнитных шариков и инкубировали в присутствии облученных спленоцитов, пептида MOG 35–55 (5–10 мкг / мл) или стимулирующего воздействия. mAb против CD3 (BD ​​Biosciences, клон 145-2C11) и против CD28 (BD Biosciences, клон 37.51), как описано ранее (12). Эксперименты проводили в присутствии 30 мкМ форсколина или 0,1% ДМСО в среде (контроль). После 72 ч инкубации мертвые клетки удаляли с помощью центрифугирования в градиенте Ficoll ™, промывали и окрашивали на поверхностные маркеры клеток CD4 и TCRVβ 11 и анализировали на включение BrdU с помощью трехцветной проточной цитометрии.

Иммуногистохимия

Фиксированные замороженные срезы поясничных областей спинного мозга были подготовлены и окрашены люксолом Fast Blue (LFB, Sigma), как мы описали ранее (10).

Статистический анализ

Результаты представлены как среднее ± стандартная ошибка. Непарный тест Стьюдента t был использован для определения значимости между двумя независимыми группами. p Значения менее 0,05 считались значимыми. Программа SigmaPlot использовалась для построения графиков и проведения статистического анализа.

Результаты

Форсколин подавляет регуляцию MHC класса II и CD86 на микроглии и макрофагах в ЦНС во время EAE, что приводит к снижению нейровоспаления и выздоровлению от болезни

На основании литературы мы предположили, что введение форсколина приведет к активации пути цАМФ в различных типах клеток, что может быть полезно для подавления ЕАЕ путем ингибирования аутоиммунных Т-клеток CD4 и / или изменения баланса поляризации макрофагов с M1 на M2.Мы начали введение форсколина в день начала заболевания, когда энцефалитогенные IFNγ и IL-17, продуцирующие клетки Th2 и Th27, были примированы и уже мигрировали в ЦНС, что привело к появлению первых клинических симптомов (рис. 1A, день 14). Введение форсколина существенно облегчило течение болезни, что привело к выздоровлению, в то время как у контрольной группы, получавшей носитель, пик заболевания приходился на 21–22 дни (рис. 1A). Мы обнаружили, что у мышей, получавших форсколин, был очень низкий уровень демиелинизации в спинном мозге, что определялось окрашиванием LFB (рис. 1B).Мыши, получавшие форсколин, имели существенно более низкий уровень процентного и абсолютного количества CD11b + CD45 hi макрофагов / активированных микроглии и CD11b лимфоцитов CD45 hi в ЦНС на 22 день (рисунки 1C, D). У мышей, получавших форсколин, также был снижен уровень экспрессии MHC класса II и CD86 на CD11b + F4 / 80 + микроглии / макрофагах в ЦНС (рисунки 1E, G), но не на CD11b + F4 / 80 + макрофагов в селезенке (Рисунки 1F, G).Таким образом, мы обнаружили, что форсколин эффективен в подавлении аутоиммунного воспаления ЦНС, что приводит к снижению экспрессии маркера активации MHC класса II и маркера M1 CD86.

Рисунок 1 . Анализ роли форсколина в модуляции нейровоспаления и экспрессии MHC класса II и CD86 в центральной нервной системе (ЦНС) и на периферии. Был индуцирован ЕАЕ, и внутрибрюшинно вводили носитель (PBS с 1% ДМСО) или форсколин. на 14, 15, 16, 17, 19, 20 и 21 дни после иммунизации, как описано в разделе «Материалы и методы».На 22 день мышей перфузировали холодным PBS, и мозг, спинной мозг и селезенку выделяли для гистологии (B) и / или анализа проточной цитометрии (C – H). (A) Показано клинического курса EAE (среднее значение ± стандартная ошибка) у 11–12 отдельных мышей для каждой группы. Инъекции носителя или форсколина указаны стрелками. (B) Гистологический анализ степени миелинизации ЦНС в коронарных срезах поясничной области спинного мозга необработанных мышей (верхнее изображение) или мышей с EAE на 22 день (нижние изображения), получавших носитель (левое изображение) или форсколин ( правое изображение).Степень миелинизации оценивали в поясничной области спинного мозга с использованием красителя люксол быстрого синего (LFB), как описано в разделе «Материалы и методы» (полоса: 50 мкм; увеличение: 400 ×). Количественный анализ процентного содержания безмиелиновых LFB-отрицательных областей показан на гистограмме справа. Показано среднее ± стандартная ошибка шести отдельных изображений от трех отдельных мышей (**** p <0,0001). (C, D) Анализ проточной цитометрии мононуклеарных клеток ЦНС, выделенных от мышей с EAE на 22 день, обработанных носителем или форсколином.Мононуклеарные клетки выделяли из ЦНС мышей с EAE, окрашивали на CD11b и CD45 и анализировали проточной цитометрией, как описано в разделе «Материалы и методы». Процентное соотношение популяций CD11b + CD45 low микроглии (левые ворота), CD11b + CD45 hi макрофагов (верхние правые ворота) и CD11b лимфоцитов CD45 hi ) (нижние правые ворота). показано. Количественная оценка абсолютного количества макрофагов и лимфоцитов в ЦНС показана на панели (D).(E – H) Анализ проточной цитометрии экспрессии M1-ассоциированных маркеров в макрофагах в ЦНС (E, G) или селезенке (F, H) мышей с EAE на 22 день, получавших носитель или форсколин . Мононуклеарные клетки из CNS (E, G) или селезенки (F, H) окрашивали на CD11b, F4 / 80, MHC класса II, а также на CD86 и CD11b + F4 / 80 + клеток анализировали на наличие экспрессия MHC класса II и CD86 с помощью четырехцветной цитометрии, как описано в разделе «Материалы и методы».Типичные гистограммы для MHC класса II (верхний ряд) и CD86 (нижний ряд) показаны на панелях (E, F) . Сплошная линия указывает на окрашивание для MHC класса II или CD86, а пунктирная линия указывает на окрашивание для контроля, соответствующего изотипу. Полоса указывает процент MHC класса II или CD86-положительных клеток. Средняя интенсивность флуоресценции (MFI) экспрессии MHC класса II или CD86 показана внизу каждой гистограммы. Количественный анализ экспрессии MHC класса II и CD86 в макрофагах в ЦНС и селезенке показан на панелях (G, H) соответственно.На панелях (D, G, H) показано среднее значение ± стандартная ошибка пяти отдельных животных (* p <0,05; ** p <0,01; *** p <0,001; NS, не достоверно ).

Форсколин усиливает регуляцию Arg1 и ингибирует NOS2 в ЦНС во время EAE путем изменения баланса в сторону M2

Мы предположили, что подавление общего маркера активации MHC класса II и маркера M1 CD86 на микроглии / макрофагах в ЦНС мышей с EAE, получавших форсколин, было связано с изменением баланса в сторону M2.Чтобы дополнительно проверить это, мы исследовали экспрессию дополнительных количеств M1 (NOS2, TNF), маркеров M2 (miR-124, Arg1, Mrc1, Ym-1, Fizz1) и общих маркеров активации макрофагов (IL-1β, IL- 6) в ЦНС контрольной группы по сравнению с группой мышей с ЭАЕ, получавшей форсколин, на 22 день. Мы обнаружили, что miR-124, Arg1, Mrc1, Ym1 и Fizz1 были активированы у мышей, получавших форсколин (рисунки 2A, B, D – F), в то время как NOS2 подавлялся (рис. 2C). Мы не обнаружили статистически значимых различий для IL-1β, IL6 и TNF (Рисунки 2G – I).Однако IL-1β и TNF имели тенденцию к повышению (Фигуры 2G, I), а IL-6 имели тенденцию к снижению (Фигуры 2H). Примечательно, что мы наблюдали резкое 19-кратное повышение регуляции Arg1 (рис. 2B) и почти неопределяемый уровень NOS2 (рис. 2C) в спинном мозге мышей с EAE, получавших форсколин. Резкое повышение регуляции Arg1 прекрасно согласуется с нашими данными in vitro (рис. 2В). Таким образом, мы обнаружили, что форсколин смещает баланс в сторону M2 в ЦНС во время EAE, что приводит к выздоровлению от болезни.

Рисунок 2 . Влияние форсколина на смещение баланса в сторону фенотипа M2 в центральной нервной системе во время EAE. Был индуцирован EAE, и носитель или форсколин вводили внутрибрюшинно. на 14, 15, 16, 17, 19, 20 и 21 дни после иммунизации аналогично тому, как показано на фиг.1. На 22 день мышей перфузировали холодным PBS, и спинной мозг выделяли для выделения и анализа РНК. Экспрессия маркеров M2 [микроРНК (miR) -124 (A) , Arg1 (B) , Mrc1 (D) , Ym1 (E) и Fizz1 F) ], маркеры M1 [ NOS2 (C) , TNF (I) ] и общие провоспалительные маркеры [IL-1β (G) , IL-6 (H) ] выполняли методом ОТ-ПЦР в реальном времени, как описано в разделе «Материалы и методы».На панелях (A – I) показано среднее значение ± стандартная ошибка для трех экземпляров (* p <0,05; ** p <0,01; *** p <0,001; NS, несущественно).

Форсколин снижает пролиферацию и продукцию IFNγ аутоиммунными CD4 Т-клетками в ЦНС, но не на периферии

Поскольку сообщалось, что форсколин может снижать пролиферацию Т-клеток, мы проверили уровень пролиферации CD4 Т-клеток в ЦНС и на периферии (селезенке) во время ЕАЕ на 22 день.Мы обнаружили, что пролиферация CD4 Т-клеток уменьшилась вдвое с 20 ± 3 до 9 ± 2% в ЦНС мышей, получавших форсколин (рисунки 3A, E). Уровень продукции IFNγ CD4 T-клетками также снижался в ЦНС в 1,5 раза, что указывает на снижение уровня активации и дифференцировки патогенных клеток Th2 (Фигуры 3B, F). Это заключалось в 6,3-кратном уменьшении абсолютного числа инфильтрирующих CD4 Т-клеток в ЦНС мышей с EAE на 22 день (рисунок 3G). В то же время форсколин не влиял на уровень пролиферации Т-лимфоцитов CD4 в селезенке (Рисунки 3C, H).Это даже была тенденция к увеличению продукции IFNγ в селезенке мышей, получавших форсколин, с EAE на 22 день; однако это не было статистически значимым (Рисунки 3D, I). Мы также обнаружили, что во время пика EAE (день 22) уровни мРНК как Th2, так и Th27 цитокинов IFNγ и IL-17A были снижены примерно в 8 раз в спинном мозге мышей, получавших форсколин, по сравнению с группой, получавшей носитель, что указывает на снижение активность клеток Th2 и Th27 (данные не показаны). Таким образом, эти данные демонстрируют, что введение форсколина снижает пролиферацию и продукцию провоспалительных цитокинов патогенными CD4 Т-клетками в ЦНС в месте воспаления, но не на периферии.

Рисунок 3 . Влияние форсколина на пролиферацию и продукцию IFNγ аутоиммунными CD4 T-клетками в центральной нервной системе (ЦНС) и на периферии во время EAE. Был индуцирован EAE, и носитель или форсколин вводили внутрибрюшинно. на 14, 15, 16, 17, 19, 20 и 21 дни после иммунизации аналогично тому, как показано на Фигуре 1. На 21 день BrdU вводили внутрибрюшинно. как описано в разделе «Материалы и методы». На 22 день мононуклеарные клетки выделяли из ЦНС или периферии (селезенки), как показано на рисунке 1, и CD4 Т-клетки анализировали на экспрессию поверхностных маркеров, включение BrdU и внутриклеточную экспрессию IFNγ, как описано в разделе «Материалы и методы».” (A, C, E, H) Для измерения пролиферации CD4 Т-клеток BrdU вводили внутрибрюшинно. За 14 ч до анализа мононуклеарные клетки выделяли из ЦНС (A, E) или селезенки (C, H) . Клетки окрашивали на CD4 ( x -ось) и BrdU ( x -ось) и анализировали с помощью двухцветной проточной цитометрии. Включение BrdU селективными клетками CD4 + показано на репрезентативных контурных диаграммах (A, C) , а статистика показана на панелях (E, H) .Процентное содержание BrdU-позитивных селективных клеток CD4 + показано в верхнем левом квадранте каждого контурного графика. Отрицательные контроли для окрашивания BrdU показаны в левом нижнем квадранте каждого контурного графика. (B, D, F, I) Для измерения продукции IFNγ Т-лимфоцитами CD4 мононуклеарные клетки выделяли из ЦНС (B, F) или селезенки (D, I) и стимулировали PMA / иономицином в наличие GolgiStop в течение 4 ч, как описано в разделе «Материалы и методы».Затем клетки окрашивали на CD4 ( x -ось) и IFNγ ( x -ось) и анализировали с помощью двухцветной проточной цитометрии. Продукция IFNγ селективными клетками CD4 + показана на репрезентативных контурных диаграммах (B, D) , а статистика показана на панелях (F, I) . Процентное содержание IFNγ-положительных клеток с закрытым входом CD4 + показано в верхнем левом квадранте каждого контурного графика. Отрицательные контроли для окрашивания IFNγ показаны в левом нижнем квадранте каждого контурного графика. (G) Мононуклеарные клетки окрашивали CD4 и TCRβ, и абсолютное количество клеток CD4 + TCRβ + количественно определяли, как показано на Фигуре 8. На панелях (E – I) , среднее ± стандартное отклонение от трех до пяти показаны отдельные мыши (* p <0,05; ** p <0,01; NS, несущественно).

Форсколин не оказывал прямого действия на пролиферацию MOG-специфичных аутоиммунных CD4 Т-клеток

Хотя мы обнаружили драматический эффект форсколина на течение заболевания EAE, поляризацию макрофагов и пролиферацию CD4 T-клеток в ЦНС, действие форсколина на MOG-специфические CD4 T-клетки может быть вторичным из-за смещения макрофагов в сторону M2, которые плохо стимулируют пролиферацию. и дифференцировка клеток Th2.Сообщалось, что форсколин напрямую подавляет пролиферацию наивных Т-клеток и линий Т-клеток, стимулированных анти-CD3, но роль форсколина в пролиферации эффекторных Т-клеток оставалась спорной (23). В наших экспериментах мы начали лечение после начала заболевания, когда энцефалитогенные Т-клетки уже были примированы и стали эффекторными Т-лимфоцитами CD4. Эти эффекторные Т-клетки CD4 не ингибировались форсколином в селезенке и имели уровень пролиферации и продукции IFNγ, аналогичный контрольной группе.Это может указывать на то, что форсколин не оказывает прямого действия на аутоиммунные Т-клетки на периферии. Чтобы решить эту проблему, мы дополнительно исследовали, влияет ли форсколин непосредственно на пролиферацию примированных MOG-специфических CD4 T-клеток in vitro и обнаружили, что форсколин имеет очень небольшую тенденцию к снижению пролиферации CD4 T-клеток от 17 ± 1 до 15 ± 1% BrdU. -положительные клетки; однако эта разница была статистически незначимой (рисунки 4A, B; верхние рисунки). Когда мы сравнивали степень пролиферации MOG-специфической обогащенной популяции CD4 + Vβ11 + T-клеток, уровень пролиферации также был очень похож для контрольных или обработанных форсколином клеток, содержащих 70–80% CD4 + Vβ11. + BrdU + ячеек (рисунки 4A, B; нижние рисунки).Интересно, что когда мы использовали моноклональные антитела к CD3 / CD28 для вызова поликлональной стимуляции в том же эксперименте вместо стимуляции антигеном MOG, мы обнаружили, что форсколин индуцировал статистически значимое 40% снижение пролиферации Т-лимфоцитов CD4 (рисунки 4C, D), как сообщалось. ранее (2, 23). Эти данные продемонстрировали, что в отличие от поликлонально стимулированных Т-лимфоцитов CD4, праймированные MOG-специфические Т-лимфоциты CD4 не были восприимчивы к прямому действию форсколина. Таким образом, мы демонстрируем, что форсколин не оказывал существенного прямого влияния на пролиферацию аутоиммунных MOG-специфических CD4 Т-клеток в нашей модели.

Рисунок 4 . Анализ прямого действия форсколина на пролиферацию миелин-олигодендроцитарных гликопротеинов (MOG) -специфических аутоиммунных Т-лимфоцитов CD4 и поликлонально стимулированных Т-лимфоцитов CD4 с помощью анти-CD3 / CD28. (A, B) Влияние форсколина на пролиферацию MOG-специфических аутоиммунных Т-лимфоцитов CD4. Мышей иммунизировали MOG 35–55 , и на 7 день выделяли спленоциты и клетки дренирующих лимфатических узлов. CD4 Т-клетки очищали с помощью магнитных шариков и культивировали с облученными спленоцитами в течение 72 часов без форсколина для контрольного образца или с форсколином (FSK), как описано в разделе «Материалы и методы».«Для измерения пролиферации Т-лимфоцитов CD4 за 14 часов до анализа добавляли BrdU. Клетки окрашивали на CD4 ( x -ось), TCRVβ11 и BrdU ( x -ось) и анализировали с помощью трехцветной проточной цитометрии. Общее количество закрытых клеток CD4 + показано на верхних контурных графиках, тогда как закрытые клетки CD4 + TCRVβ11 + показаны на нижних контурных графиках на панели (A) . Процентное содержание BrdU-позитивных CD4 + , стробированных (верхние контурные графики) или CD4 + TCRVβ11 + стробированных (нижние контурные графики) CD4 Т-клеток показано в верхнем левом квадранте каждого контурного графика.Отрицательные контроли для окрашивания BrdU показаны в левом нижнем квадранте каждого контурного графика. Среднее значение ± стандартная ошибка (SE) для четырех лунок с культурой показано на панели (B) (NS, несущественно). (C, D) Влияние форсколина на пролиферацию поликлонально стимулированных Т-лимфоцитов CD4 с помощью анти-CD3 / CD28. Процентное содержание BrdU-положительных CD4 + Т-клеток показано в верхнем левом квадранте каждого контурного графика (C) . Отрицательные контроли для окрашивания BrdU показаны в левом нижнем квадранте каждого контурного графика.Среднее значение ± стандартная ошибка среднего для четырех лунок с культурой показано на панели (B) (*** p <0,001).

Форсколин синергизирует IL-4 в повышении регуляции miR-124 и Arg1 даже в присутствии IFNγ

Поскольку недавно было продемонстрировано, что цАМФ способствует поляризации M2 (24, 25), мы предположили, что форсколин может усиливать IL-4 в поляризации M2. Мы проанализировали экспрессию M2-ассоциированных молекул miR-124, Arg1, Mrc1, Ym1, Fizz1 и M1-ассоциированного NOS2 в присутствии форсколина в M0 (контроль), M2 (IL-4), M1 (IFNγ) и смешанные условия M1 / ​​M2 (IL-4 и IFNγ).Эксперименты продемонстрировали, что комбинация форсколина с IL-4 приводила к 3–5-кратной активации miR-124, в среднем в 3,3 раза (фиг. 5A, IL4 FSK). Однако, что более поразительно, мы обнаружили 3,4-кратную активацию miR-124, когда форсколин использовался вместе с IL-4 и IFNγ (рис. 5A, IL-4 IFN FSK). В то же время IL-4 и IFNγ не могут активировать miR-124. Это указывает на то, что форсколин преодолевает ингибирующее действие IFNγ в индуцированной IL-4 экспрессии miR-124, когда IL-4 используется вместе с IFNγ.

Рисунок 5 . Влияние форсколина на экспрессию микроРНК (miR) -124, аргиназы (Arg) 1, Mrc1 и синтетазы оксида азота (NOS) 2 в макрофагах, полученных из костного мозга (BM), в исходном состоянии (контроль), условиях поляризации M2 ( IL-4), состояние M1 (IFNγ) или смешанные воспалительные состояния (IL-4 и IFNγ). Макрофаги, полученные из BM, выращивали в течение 5 дней в присутствии M-CSF, как описано в разделе «Материалы и методы», и обрабатывали форсколином, или IL-4, или IFNγ, или форсколином / IL-4, или форсколином / IFNγ. или форсколин / IL-4 / IFNγ.Через 24 часа выражения miR-124 (A) , Arg1 (B) , Mrc1 (C) и NOS2 (D) были проанализированы с помощью RT в реальном времени. -ПЦР, как описано в разделе «Материалы и методы». Показано среднее значение ± стандартная ошибка (SE) от четырех до восьми лунок (* p <0,05; ** p <0,01; *** p <0,001; **** p <0,0001).

В дополнение к miR-124, форсколин существенно усиливал IL-4 в индукции Arg1 в макрофагах M2 (рис. 5B).Форсколин усиливал экспрессию Arg1 в 18 раз по сравнению с действием одного IL-4 (фиг. 5B; IL4 и IL4 FSK). Форсколин активировал Arg1 в пять раз в смешанных воспалительных условиях в присутствии IL-4 и IFNγ (фиг. 5B; IFN IL4 и IFN IL4 FSK). Этот препарат также усиливал экспрессию маркера M2 , Mrc1 ; однако он не смог вызвать его при смешанных воспалительных состояниях (рис. 5C). Наконец, форсколин не оказал существенного влияния на индуцированную IL-4 экспрессию двух других протестированных маркеров M2 Ym1 и Fizz1 (данные не показаны).

Когда мы сравнили экспрессию маркеров M1 в макрофагах, активированных IL-4 и IFNγ, мы обнаружили, что форсколин сам по себе индуцировал низкий уровень экспрессии NOS2 и усиливал индукцию NOS2 IFNγ (рис. 5D). Хотя было показано, что Arg1 и NOS2 являются антагонистическими маркерами, форсколин индуцировал оба в смешанных воспалительных условиях, но уровень Arg1 был более чем в 10 раз выше, чем NOS2 (Фигуры 5B, D, IFN IL4 FSK ).Наконец, форсколин не влиял на экспрессию других маркеров M1 CD86 и TNF (данные не показаны).

Взятые вместе, эти данные показывают, что форсколин синергизирует действие IL-4 при индукции miR-124 и Arg1 в состоянии M2-перекоса в присутствии IL-4 и смешанных воспалительных условиях (IL-4 с IFNγ), изменяя баланс в направлении M2.

Форсколин активирует ERK и синергизирует активацию пути ERK с помощью IL-4

Мы дополнительно исследовали механизм, с помощью которого форсколин индуцирует экспрессию маркеров M2.Сообщалось, что CEBPβ ​​может фосфорилироваться ERK1 / 2 в ответ на IFNγ в линии макрофагальных клеток мыши, которые играют важную роль в экспрессии IFNγ-индуцируемых генов, таких как NOS2 (26, 27). С другой стороны, было показано, что ось CREB-CEBPβ ​​активируется в LPS-обработанных макрофагах, что приводит к экспрессии ряда генов M2, включая Arg1 и Mrc1 , в то время как гены M1 остаются неизменными (28). Таким образом, роль осей ERK – CEBPβ ​​и CREB – CEBPβ ​​в M1 vs.М2 так и остался неясным. Мы проверили, влияют ли IL-4 и / или форсколин на активацию CREB, ERK и CEBPβ, индуцируя их активацию и / или фосфорилирование.

Сначала мы исследовали раннюю кинетику уровня экспрессии и степень фосфорилирования CREB, ERK и CEBPβ ​​после 10, 30 и 60 минут инкубации с форсколином. Мы обнаружили, что активация CREB (рисунок 6A; рисунок S1 в дополнительном материале) и фосфорилирование (рисунок 6B; рисунок S1 в дополнительном материале) были обнаружены через 10–60 минут после инкубации с форсколином.Мы обнаружили очень умеренную активацию CEBPβ ​​(рис. 6C; рис. S1 в дополнительном материале) и лишь небольшое увеличение фосфорилирования CEBPβ ​​(рис. 6D; рис. S1 в дополнительном материале) после 30–60 мин инкубации с форсколином. Форсколин индуцировал легкое подавление (рис. 6E; рис. S1 в дополнительных материалах) и значительное повышение уровня фосфорилирования ERK1 / 2, которое было обнаружено через 10–60 мин инкубации с форсколином (рис. 6F; рис. S1 в дополнительных материалах).

Рисунок 6 . Влияние форсколина на раннюю активацию нижестоящих сигнальных путей CREB, CEBPβ ​​и ERK1 / 2. Макрофаги, полученные из костного мозга, выращивали в течение 5 дней в присутствии M-CSF и анализировали как необработанные (контроль) или обрабатывали форсколином (FSK) в течение 10, 20 или 30 минут. Экспрессии CREB, CEBPβ ​​и ERK1 / 2 и их фосфорилированных форм (p-CREB, p-CEBPβ ​​и p-ERK) анализировали вестерн-блоттингом, как описано в разделе «Материалы и методы». β-Актин использовали в качестве контроля нагрузки. (A, C, E) Показан количественный анализ относительных уровней экспрессии CREB, CEBPβ ​​и ERK, нормализованных к β-актину. Типичное изображение показано на рисунке S1 в дополнительных материалах. (B, D, F) Показан количественный анализ относительных уровней экспрессии p-CREB, p-CEBPβ ​​и p-ERK, нормализованных к общему количеству CREB, CEBPβ ​​и ERK1 / 2, соответственно. Типичное изображение показано на рисунке S1 в дополнительных материалах. На панелях (A – D) показано среднее значение ± стандартная ошибка трех отдельных экспериментов.

Во-вторых, мы исследовали долгосрочное влияние форсколина и / или активирующих стимулов M1 (IFNγ) и M2 (IL-4) на экспрессию и степень фосфорилирования CREB, ERK и CEBPβ ​​после 24 часов инкубации с форсколином. Мы обнаружили, что CREB активируется IFNγ и IL-4 (фигура 7A; фигура S1 в дополнительном материале), в то время как самый высокий уровень фосфорилирования CREB наблюдался в макрофагах, обработанных IL-4 вместе с форсколином (фигура 7B, IL4 / F ; фигура S1 в дополнительном материале), которая была заблокирована ингибитором ERK U0126 (фигура 7B, IL4 / F / U ; фигура S1 в дополнительном материале).Интересно, что мы обнаружили, что IL-4 вызывал наивысший уровень экспрессии CREB через 24 часа, что указывает на важную роль цАМФ в обычных IL-4-поляризованных макрофагах (рис. 7A). Большинство активирующих стимулов (только IFNγ, только IL-4 или IL-4 с форсколином или IFNγ с форсколином) активировали CEBPβ ​​с небольшой разницей в степени фосфорилирования CEBPβ ​​(Фигуры 7C, D; Рисунок S1 в дополнительных материалах). Ингибитор ERK не подавлял экспрессию CEBPβ ​​(фиг. 7C). На экспрессию ERK не влияло большинство активирующих стимулов, в то время как IFN / Forskolin и IL-4 / Forskolin даже снижали ее (Рисунок 7E; Рисунок S1 в дополнительных материалах).Однако фосфорилирование ERK1 / 2 было немного усилено IL-4 или форсколином, но самый высокий уровень фосфорилирования ERK наблюдался, когда IL-4 был добавлен вместе с форсколином (фигура 7E; фигура S1 в дополнительном материале). Напротив, один IFNγ действительно вызывал существенное фосфорилирование ERK, но форсколин с IFNγ существенно усиливал фосфорилирование ERK1 / 2. Ингибитор ERK U0126 блокировал фосфорилирование ERK1 / 2, вызванное IL-4 вместе с форсколином, или IFNγ с форсколином (фигура 7E).Таким образом, мы пришли к выводу, что форсколин усиливал действие IL-4 при фосфорилировании ERK1 / 2 и CREB, но путь ERK не играл существенной роли в фосфорилировании CEBPβ.

Рисунок 7 . Влияние форсколина на активацию нижестоящих сигнальных путей CREB, CEBPβ ​​и ERK1 / 2 в макрофагах M0 (контроль) или в условиях поляризации M2 (IL-4) по сравнению с M1 (IFNγ). Макрофаги, полученные из костного мозга, выращивали в течение 5 дней в присутствии M-CSF и обрабатывали форсколином, или IL4, или IFNγ, или форсколином / IL4, или форсколином / IFNγ, или форсколином / IL4 / IFNγ в течение 24 часов, как в Рисунок 1.Ингибитор ERK1 / 2 U0126 использовали для блокирования фосфорилирования ERK1 и ERK2 (см. Материалы и методы). Экспрессию CREB, CEBPβ ​​и ERK1 / 2 и их фосфорилированных форм (p-CREB, p-CEBPβ ​​и p-ERK1 / 2) анализировали с помощью вестерн-блоттинга, как описано в разделе «Материалы и методы». β-Актин использовали в качестве контроля нагрузки. (A, C, E) Показан количественный анализ относительных уровней экспрессии CREB, CEBPβ ​​и ERK, нормализованных к β-актину. Типичное изображение показано на рисунке S1 в дополнительных материалах. (B, D, F) Показан количественный анализ относительных уровней экспрессии p-CREB, p-CEBPβ ​​и p-ERK, нормализованных к общему количеству CREB, CEBPβ ​​и ERK1 / 2, соответственно. Типичное изображение показано на рисунке S1 в дополнительных материалах. На панелях (A – D) показано среднее значение ± стандартная ошибка трех отдельных экспериментов. Сокращения: IFN, IFNγ; ИЛ4, ИЛ-4; F, форсколин; U, U0126.

Ингибиторы ERK блокируют повышающую регуляцию Arg1, Mrc1 и miR-124, индуцированную форсколином с IL-4

Мы обнаружили, что форсколин активировал путь ERK1 / 2 и стимулировал экспрессию маркеров M2.Мы предположили, что форсколин индуцировал экспрессию маркеров M2 и miR-124 через активацию ERK1 / 2. Однако в настоящее время неясно, способствует ли ERK1 / 2 поляризация M2 или нет. Сообщалось, что активация ERK1 / 2 вносит вклад в фенотипы M1 и M2 (26, 29–32). Было показано, что роль ERK важна для Th3-опосредованного аллергического воспаления легких (33), в то время как роль miR-124 также была показана в наших исследованиях как важная для EAE и аллергического воспаления легких (10, 17).Поэтому мы дополнительно исследовали роль пути ERK в повышающей регуляции miR-124, Arg1, Mrc1 и NOS2 , индуцированных IL-4 вместе с форсколином. Мы обнаружили, что в присутствии ингибитора ERK U0126 экспрессия miR-124 упала ниже контрольного уровня (таблица 1, miR-124). В дополнение к U0126 мы использовали другой ингибитор ERK P184352 для подтверждения ингибирующего действия U0126. Оба ингибитора ERK U0126 и P184352 подавляли экспрессию Arg1 на 58 и 98% соответственно (таблица 1, Arg1).Оба ингибитора U0126 и P184352 увеличивали экспрессию NOS2 в четыре и семь раз соответственно (таблица 1, NOS2). В то же время U0126 снижал экспрессию Mrc1 на 50%, повышал экспрессию Ym1 на 25% и не влиял на экспрессию Fizz1 (Таблица 1). Таким образом, мы обнаружили, что путь ERK вносит существенный вклад в активацию miR-124 и Arg1 и подавление активности NOS2 , вызванную одновременным действием IL-4 и форсколина.В то же время мы обнаружили, что форсколин усиливает IFNγ, вызывая экспрессию NOS2 (фиг. 5D, NOS2). Мы исследовали, вносит ли ERK-путь вклад в этот процесс, как это было описано ранее для линии клеток RAW 264.7 (26). Мы действительно обнаружили, что путь ERK частично способствует экспрессии IFNγ-индуцибельной NOS2 , поскольку U0126 снижает экспрессию NOS2 на 21% (таблица 2, NOS2). Однако ингибирование пути ERK привело к двукратному увеличению экспрессии TNF (таблица 2), что указывает на то, что ERK частично вносит вклад в IFNγ-индуцибельную NOS, но не влияет на другой маркер M1 TNF.Таким образом, путь ERK способствовал усилению регуляции маркеров M2 miR-124 и Arg1 (таблица 1) и частично NOS2 и подавлению TNF (таблица 2). Эти данные продемонстрировали важность пути ERK в экспрессии маркеров M2 miR-124 и Arg1.

Таблица 1 . Влияние ингибиторов ERK U0126 и PD184352 на индуцированную IL-4 / форсколином экспрессию микроРНК (miR) -124, Arg1, NOS2, Mrc1, Ym1 и Fizz1 . а

Таблица 2 .Влияние ингибитора ERK U0126 на IFNγ / форсколин-индуцированную экспрессию NOS2 и TNF . а

Ингибитор ERK усиливает регуляцию Arg1, Mrc1 и циклина D2 и усиливает NOS2 в макрофагах, полученных из BM, активируемых IL-4

Поскольку ингибиторы ERK подавляли индуцированную IL-4 / форсколином экспрессию miR-124 и Arg1 (таблица 1), мы предположили, что путь ERK важен для повышения регуляции маркеров M2 в обычных макрофагах M2, поляризованных IL-4 без форсколина.Наша гипотеза также была основана на обнаружении того, что один только ИЛ-4, но не один только IFNγ, вызывает фосфорилирование ERK1 / 2 (рис. 7). Было высказано предположение, что ERK вносит вклад в фенотип M2 для инфильтрирующих опухоль макрофагов (TIMs) (29, 30), но не было доказано, что роль ERK является существенной для IL-4-активированных макрофагов в качестве общей концепции. Далее мы сравнили экспрессию нескольких маркеров M2 в макрофагах, полученных из ВМ, поляризованных по IL-4, с ингибитором U0126 и без него. Мы обнаружили, что путь ERK является критическим для индуцированной IL-4 активации Arg1, Mrc1 (Фигуры 8A, B), но не Ym1 и Fizz1 (Фигуры 8C, D).Более того, Ym1 дополнительно активируется ингибитором ERK U0126 (фигура 8D). Мы также исследовали уровень экспрессии члена семейства CREB / ATF ATF3 в качестве фактора транскрипции, который регулируется цАМФ, и обнаружили, что ATF3 активируется IL-4, что предполагает возможное участие этого фактора транскрипции в поляризации M2 (рис. 8E). Ингибитор ERK U0126 еще больше усиливал ATF3 в макрофагах, обработанных IL-4 (фиг. 8E), демонстрируя, что другие пути и / или кофакторы несут ответственность за активацию ATF3.Таким образом, мы подтвердили, что путь ERK важен для активации Arg1 и Mrc1 с помощью IL-4. Мы также обнаружили, что в дополнение к CREB, ATF3 может также участвовать в процессе поляризации M2, но экспрессия этого фактора не зависит от ERK.

Рисунок 8 . Анализ роли пути ERK в повышении регуляции маркеров M2 и пролиферативной способности макрофагов, происходящих из костного мозга (BM), поляризованных с помощью IL-4. Макрофаги, полученные из BM, выращивали в течение 5 дней в присутствии M-CSF и анализировали как необработанные (контроль) или обработанные IL-4, или IL-4 с ингибитором ERK U0126 в течение 24 часов, как показано на Фигуре 2. (A – F) Анализ экспрессии маркера M2. Чтобы оценить экспрессию M2-ассоциированных маркеров и маркеров пролиферации, была выделена РНК, и экспрессия Arg1, Mrc1, Ym1, Fizz1, ATF3 и CCDN1 (Cyclin D1) была проанализирована с помощью ОТ-ПЦР в реальном времени, как описано в Раздел «Материалы и методы». (G, H) Анализ разрастания макрофагов. Для оценки пролиферации макрофагов BrdU добавляли за 14–16 ч до анализа в культуры клеток, после чего клетки окрашивали на поверхностные маркеры CD11b и F4 / 80 и внутриклеточный BrdU и анализировали с помощью трехцветной проточной цитометрии, как описано в разделе «Материалы и Методы.Типичные контурные графики для CD11b + F4 / 80 + закрытых ячеек показаны на панели (G) . Экспрессия F4 / 80 показана на оси x , а экспрессия BrdU показана на оси y . Процент BrdU-положительных клеток показан в верхнем правом квадранте каждого контурного графика. Количественный анализ среднего ± SE процентов клеток CD11b + F4 / 80 + BrdU + показан на панели (H) . На панелях (A – F, H) показано среднее значение ± стандартная ошибка от трех до пяти лунок для культивирования (** p <0.01; *** р <0,001; **** p <0,0001; ***** р <0,00001).

Ранее сообщалось, что макрофаги M2 обладают пролиферативной способностью in vivo при системном введении IL-4 (34). Поскольку сообщалось, что пролиферация резидентных в ткани макрофагов в брюшной полости (35) и микроглии в ЦНС во время EAE (14) может быть связана с активацией пути ERK, мы исследовали уровень экспрессии Cyclin D (CCDN1).CCDN1 играет центральную роль в регуляции клеточного деления и необходим (но недостаточен без других кофакторов, таких как CDK4 и CDK6) для перехода от G1 к S-фазе клеточного цикла (36). Мы обнаружили, что в макрофагах, происходящих из BM, CCDN1 экспрессировался на базовом уровне, что неудивительно, поскольку эти клетки размножались в культуре в присутствии M-CSF. Однако IL-4 дополнительно активировал мРНК циклина D1 (фиг. 8F, IL4), и экспрессия CCDN1 полностью блокировалась ингибитором ERK (фиг. 8F, IL4 U0126).Это указывает на то, что и M-CSF, и IL-4 способствовали ERK-зависимой экспрессии CCDN1 в макрофагах, происходящих из BM. Мы подтвердили опубликованное исследование, что M-CSF индуцировало фосфорилирование ERK (37) в макрофагах, происходящих из BM (данные не показаны), предполагая, что как IL-4, так и M-CSF могут вносить вклад в ERK-зависимую экспрессию CCDN1 . Несмотря на заметное усиление экспрессии CCDN1 с помощью IL-4, мы не обнаружили очень резких различий в пролиферации обработанных IL-4 макрофагов in vitro , вероятно, из-за исходного уровня пролиферации этих клеток, вызванной M-CSF ( Рисунки 8G, H).Однако ингибитор ERK U0126 действительно уменьшал пролиферацию обработанных IL-4 макрофагов BM на 60%, что соответствовало снижению экспрессии CCDN1 в присутствии ингибитора ERK (Фигуры 8G, H). Таким образом, мы обнаружили, что путь ERK является критическим для экспрессии Arg1, Mrc1 и CCDN1 и подавления NOS2 .

Ингибитор ERK усиливает экспрессию маркера M1 CD86 в макрофагах, активированных IL-4, и NOS2 в макрофагах, активированных IFNγ

Мы дополнительно исследовали и обнаружили, что ингибитор ERK U0126 усиливает экспрессию маркера общей активации MHC класса II и маркера M1 CD86 в обработанных IL-4 макрофагах BM, но не в макрофагах, обработанных IFNγ (фигура 9A; таблица 3).Кроме того, ингибитор ERK дополнительно усиливал экспрессию NOS2 (фиг. 9B), но не TNF (фиг. 9C). Мы наблюдали тенденцию к активации ингибитором ERK MHC класса II в макрофагах, обработанных IFNγ (фигура 9A), но эта тенденция не является статистически значимой (таблица 3). Таким образом, мы обнаружили, что путь ERK является антагонистическим по отношению к экспрессии маркера активации MHC класса II и маркеров M1 CD86 и NOS2 .

Рисунок 9 . Анализ роли пути ERK в активации маркеров M1 в макрофагах, происходящих из костного мозга (BM), поляризованных с помощью IFNγ.Макрофаги, полученные из BM, выращивали в течение 5 дней в присутствии M-CSF и анализировали как необработанные (контроль) или обработанные IFNγ, или IFNγ с ингибитором ERK U0126, как описано в разделе «Материалы и методы». (A) Анализ экспрессии поверхностных маркеров MHC класса II и CD86 на макрофагах, происходящих из BM. Чтобы оценить экспрессию маркера активации макрофагов MHC класса II и маркера M1 CD86, макрофаги окрашивали на CD11b и F4 / 80, MHC класса II и CD86. Управляемые клетки CD11b + F4 / 80 + анализировали на экспрессию MHC класса II и CD86 с помощью четырехцветной проточной цитометрии, как описано в разделе «Материалы и методы».Показана типичная гистограмма экспрессии MHC класса II (верхний ряд) и CD86 (нижний ряд) CD11b + F4 / 80 + закрытых клеток. Сплошная линия указывает на окрашивание для MHC класса II или CD86, а пунктирная линия указывает на окрашивание для контроля, соответствующего изотипу. Полоса показывает процент MHC класса II или CD86-положительных клеток. Средняя интенсивность флуоресценции (MFI) экспрессии MHC класса II или CD86 показана внизу каждой гистограммы. (B, C) Анализ экспрессии маркеров синтетазы оксида азота (NOS) 2 и TNF M1.Чтобы оценить экспрессию двух других M1-ассоциированных маркеров NOS2 и TNF , была выделена РНК и проанализированы экспрессии NOS2 и TNF с помощью ОТ-ПЦР в реальном времени, как описано в разделе «Материалы и методы». На панелях (B, C) показано среднее значение ± стандартная ошибка от трех до пяти лунок для культивирования (*** p <0,001; **** p <0,0001).

Таблица 3 . Влияние ингибитора ERK U0126 на экспрессию маркеров клеточной поверхности MHC класса II и CD86 в M2 (IL-4) — и M1 (IFNγ) -поляризованных макрофагах, полученных из костного мозга (BM). а

Ингибитор ERK усиливает регуляцию Arg1, Mrc1 и циклина D1 в резидентных перитонеальных макрофагах, активированных IL-4

Мы подтвердили наши результаты, полученные на пролиферирующих макрофагах, происходящих из BM, в непролиферирующих резидентных перитонеальных макрофагах. Это подтверждение было также важно для доказательства существенной роли ERK в поляризации M2 различных типов макрофагов, стимулированных IL-4. Подобно макрофагам, происходящим из BM, путь ERK был критическим для индуцированной IL-4 активации Arg1 и Mrc1 , но не Ym1 или Fizz1 (Фигуры 10A – D). ATF3 еще больше усиливался ингибитором ERK U0126 по сравнению с макрофагами, происходящими из BM (фиг. 10E). Как и ожидалось, CCDN1 не экспрессируется в непролиферирующих перитонеальных макрофагах, но индуцируется IL-4 и полностью блокируется ингибитором ERK (фиг. 10F). Мы подтвердили, что обработанные IL-4 перитонеальные макрофаги не пролиферируют in vitro (данные не показаны), что указывает на то, что другие кофакторы (например, M-CSF) и другие пути (например, Akt) (35), вероятно, будут необходимы для их описанной IL-4-управляемой пролиферации in vivo .Таким образом, эти данные демонстрируют важность пути ERK в индуцированной IL-4 экспрессии Arg1, Mrc1 и Cyclin D2 в перитонеальных макрофагах. Это также поддерживает нашу общую концепцию, что ERK является важным путем активации M2.

Рисунок 10 . Анализ роли пути ERK в повышении регуляции M2-ассоциированных маркеров в перитонеальных макрофагах, поляризованных с помощью IL-4. Перитонеальные макрофаги выделяли, как описано в разделе «Материалы и методы», и анализировали как необработанные (контроль) или обработанные IL-4 или IL-4 с ингибитором ERK U0126 в течение 24 часов, как показано на Фигуре 8.Для оценки экспрессии M2-ассоциированных маркеров и маркеров пролиферации была выделена РНК, и экспрессия Arg1, Mrc1, Ym1, Fizz1, ATF3 и CCDN1 (Cyclin D1) была проанализирована с помощью ОТ ПЦР в реальном времени, как показано на рисунке 3. На панелях (A – F) показано среднее значение ± стандартная ошибка от трех до пяти лунок с культурой (* p <0,05; ** p <0,01; *** p <0,001; NS, не значительный).

Форсколин усиливает экспрессию miR-124 в макрофагах, производных от BM, зависимым от CREB / ATF3 образом

Ранее мы обнаружили, что miR-124 играет важную роль в поляризации макрофагов M2 в ЦНС и на периферии, что приводит к подавлению EAE (10, 17).Здесь мы обнаружили, что форсколин влияет на экспрессию miR-124 в макрофагах. Мы предположили, что форсколин индуцирует транскрипцию предшественников miR-124, влияя на цАМФ-чувствительные факторы транскрипции. Выполнив in silico анализ промоторных областей РНК-предшественников miR-124 pre-miR124-1, pre-miR-124-2 и pre-miR-124-3, мы обнаружили наличие сайтов связывания для нескольких факторов транскрипции. из семейства факторов транскрипции CREB / ATF, реагирующих на цАМФ, в промоторных областях pre-miR124-2 и pre-miR-124-3 (рис. S2 в дополнительных материалах).Наиболее важными факторами из списка потенциальных регуляторов miR-124 (Рисунок S1 в дополнительных материалах) были ATF3 и CREB. CREB активируется форсколином (фиг. 6A), тогда как ATF3 активируется в макрофагах M2 с помощью IL-4 (фиг. 8E и 10E). Было показано, что это индуцируется IFNβ, известным лекарственным средством, одобренным FDA (38). Кроме того, недавно было обнаружено, что ATF3 индуцируется в миелоидных клетках диметилфумаратом, другим лекарством, используемым для лечения рассеянного склероза (39, 40). Было также показано, что ATF3 способствует передаче сигналов противовоспалительного TGFβ и ингибирует TNF, что связано с фенотипом макрофагов M2 (41–43).Однако, когда мы использовали тауролидин, известный активатор ATF3 (44), мы обнаружили лишь умеренную 1,5-кратную активацию miR-124 (рисунок S3 в дополнительных материалах). Недавно было показано, что ось CREB-CREBβ играет основную роль в индукции экспрессии M2-ассоциированных генов Arg1 и Mrc1 (28). Форсколин индуцировал раннее фосфорилирование CEBPβ ​​(фиг. 6B), показывая активацию оси CREB-CEBPβ ​​в макрофагах под действием форсколина. Таким образом, мы обнаружили, что форсколин существенно активировал miR-124 в макрофагах, действуя через активацию CERB.

REST не играет роли в повышении регуляции miR-124 в необработанных или обработанных форсколином макрофагах

Было показано, что miR-124 высоко экспрессируется в нейронах из-за инактивации репрессора транскрипции REST (45). Мы также обнаружили, что в отличие от нейронных клеток, REST (но не другая альтернативная изоформа сплайсинга REST4) высоко экспрессируется в макрофагах на уровнях мРНК (рисунок S4A в дополнительном материале) и белка (рисунок S4B в дополнительном материале). Важно отметить, что экспрессия REST не подавлялась форсколином (рисунки S4A, B в дополнительном материале).Таким образом, Форсколин не подавлял или функционально подавлял REST. Более того, ингибитор REST X5050 не смог активировать miR-124 в нестимулированных макрофагах (рисунок S4C в дополнительном материале), в то время как применение ингибирующей REST РНК (NRSE) привело только к умеренной 1,5-кратной активации miR-124 (рисунок S4D в дополнительном материале). . Таким образом, мы продемонстрировали, что форсколин активировал miR-124 в макрофагах REST-независимым образом.

Обсуждение

Это исследование показало, что путь цАМФ более важен для модуляции функции макрофагов, чем Т-клеток во время EAE.Мы продемонстрировали важность пути ERK для поляризации M2, индуцированной одним IL-4 или синергетическим действием Forskolin и IL-4, приводящим к усилению регуляции miR-124, Arg1 и Mrc1 . Форсколин также усиливал действие IFNγ, ведущего фосфорилирование ERK и повышающую регуляцию NOS2; однако этот эффект был примерно в 10 раз слабее по сравнению со стимуляцией Arg1 . Кроме того, мы обнаружили, что в отличие от форсколина и IL-4, IFNγ сам по себе не индуцирует фосфорилирование ERK.Ранее мы обнаружили, что miR-124 способствует экспрессии Arg1 и Mrc1 и ингибирует NOS2 (10, 17), дополнительно способствуя фенотипу M2. Обобщая все наши данные, мы предложили модель, в которой IL-4 и форсколин активируют путь ERK, который способствует экспрессии miR-124, Arg1 и Mrc1 (рисунок 11). Форсколин сам по себе или в комбинации с IFNγ также способствует NOS2, но этот путь, вероятно, антагонист miR-124, который, как мы обнаружили, является критическим для фенотипа M2 макрофагов в ЦНС (10) (рис. 11).Наши исследования in vitro были дополнительно протестированы на модели in vivo на мышиной модели аутоиммунного нейровоспаления, продемонстрировав сильный терапевтический эффект форсколина и изменение баланса по отношению к M2 в ЦНС на мышиной модели рассеянного склероза.

Рисунок 11 . Модель изменения баланса в сторону M2 с помощью форсколина в смешанных воспалительных условиях в присутствии IFNγ и IL4 в центральной нервной системе (ЦНС) во время EAE. Наше исследование продемонстрировало, что IFNγ приводит к усилению регуляции маркера M1 синтетазы оксида азота (NOS) 2 ERK-независимым образом, поскольку IFNγ сам по себе не приводит к фосфорилированию ERK.Однако IFNγ и форсколин приводят к фосфорилированию ERK1 / 2, что способствует экспрессии NOS2. Один только IL-4 приводил к усилению регуляции маркеров M2 microRNA (miR) -124, аргиназы (Arg) 1 и Mcr1 ERK-зависимым образом. Форсколин синергизирует IL-4, вызывая фосфорилирование ERK и дальнейшую активацию miR-124, Arg1 и Mrc1 ERK-зависимым образом. Повышающая регуляция miR-124 с помощью IL-4 и / или форсколина дополнительно активирует Arg1 и подавляет NOS2, способствуя смещению макрофагов в сторону M2 под действием форсколина в присутствии как IL-4, так и IFNγ.Таким образом, форсколин смещает баланс в сторону M2 при смешанных воспалительных состояниях, таких как аутоиммунное воспаление ЦНС во время EAE.

Точная роль пути ERK в поляризации макрофагов остается загадкой. Было показано, что путь ERK необходим для развития макрофагов и искажения M2 моноцитов под действием M-CSF во время их роста и дифференцировки по сравнению с фенотипом M1, когда моноциты размножаются в дифференцированных под действием GM-CSF (30, 37) . Однако роль пути ERK в обычных макрофагах M2, поляризованных с помощью IL-4, подробно не исследовалась.Гораздо меньше известно об активации пути ERK в макрофагах во время EAE в смешанных воспалительных условиях (IL-4 и IFNγ) и возможном исходе активации этого пути в макрофагах для развития и разрешения нейровоспаления. Наши данные подтвердили, что M-CSF-индуцированное фосфорилирование ERK, но мы также продемонстрировали, что IL-4 индуцировал фосфорилирование ERK1 / 2, которое резко увеличивалось при использовании IL-4 вместе с форсколином. Более того, мы продемонстрировали, что фосфорилирование ERK1 / 2 является критическим для экспрессии miR-124, Arg1, Mrc1 и циклина D1 в макрофагах M2, которые поляризованы IL-4 с форсколином или без него.В дополнение к активации M2 с помощью IL-4 на модели диабета было показано, что TGFβ1 в сочетании с высоким уровнем глюкозы приводит к ERK-зависимой активации Arg1, предполагая, что путь ERK участвует в регуляции Arg1, индуцированной другими стимулами M2, такими как TGFβ1 (46). Эти данные подтверждают наши выводы о том, что ингибитор ERK блокирует активацию Arg1, вызванную IL-4. В качестве дополнительной поддержки наших данных с ингибиторами ERK недавно было показано, что противоопухолевый препарат пуерарин ингибирует путь ERK в TIMs или в макрофагах, обработанных IL-4, смещая баланс в сторону M1 (29).Таким образом, стимуляция пути ERK в макрофагах оказалась полезной для искажения M2 и подавления Th2 / 17-управляемого аутоиммунного воспаления, и наоборот, , ингибирование пути ERK является преимуществом для искажения M1 в микроокружении опухоли и стимуляции противоопухолевого иммунитета. . Взятые вместе, модуляция пути ERK в макрофагах открывает новые возможности для изменения баланса M1 / ​​M2 при различных заболеваниях, от диабета и рака до аутоиммунных нарушений и аллергии.

Путь

ERK традиционно связан с пролиферативной способностью клеток; однако его роль в пролиферации макрофагов до сих пор не ясна (47). Было обнаружено, что резидентные в ткани макрофаги M2 (включая резидентную микроглию ЦНС во время EAE) обладают высокой пролиферирующей способностью in vivo по сравнению с макрофагами M1, но молекулярная основа этого явления осталась неизвестной (14, 34). Было показано, что форсколин-индуцированная пролиферация макрофагов, вызванных тиогликолятом, демонстрирует важную роль CREB в пролиферации макрофагов во время воспаления (48).Наше исследование связывало форсколин с активацией ERK и подчеркивало важность пути ERK с точки зрения усиления экспрессии циклина D1 и усиления пролиферации макрофагов с помощью IL-4. Однако мы также обнаружили, что активация пути ERK необходима, но недостаточна для индукции и опосредования пролиферации макрофагов M2. Дальнейшие исследования выяснят роль других путей помимо ERK в этом процессе. Одним из возможных кандидатов является путь Akt, который также индуцируется M-CSF и, вероятно, IL-4 (35, 48).

Было показано, что путь

ERK важен in vivo для аллергического воспаления легких (33). На модели EAE недавно было показано, что ингибирование ERK приводит к подавлению регуляции GM-CSF, цитокина, который способствует поляризации M1 (49, 50). Однако роль ERK in vivo при аутоиммунном нейровоспалении трудно оценить, поскольку помимо макрофагов ингибиторы ERK также влияют на Т-клетки CD4 и дендритные клетки (51, 52). Наше исследование предполагает, что стимуляция пути ERK полезна во время нейровоспаления, изменяя баланс в сторону M2 при индукции miR-124.Ранее мы продемонстрировали, что miR-124 очень важен in vivo для моделей EAE и аллергического воспаления легких, способствующих поляризации M2, но не влияя на CD4 T-клетки и дендритные клетки (10, 17). Таким образом, форсколин является многообещающим препаратом, который стимулирует miR-124 в макрофагах и подавляет аутоиммунное нейровоспаление.

Роль цАМФ в поляризации M2 недавно была подчеркнута в нескольких исследованиях (24, 25, 28). Также было продемонстрировано, что обработка культивированных макрофагов 8-бром-цАМФ вместе с IL-4 синергетически активировала промотор Arg1 (53).Мы подтвердили, что агент, повышающий цАМФ, форсколин также синергизирует IL-4, вызывая 18-кратную активацию Arg1. Наше исследование также впервые продемонстрировало важную роль пути ERK, который, скорее всего, модулирует или служит кофактором для других известных путей, таких как ось CREB – CEBPβ ​​и STAT6 (28, 53). В настоящее время роль цАМФ в модуляции активности ERK остается спорной. Было показано, что во время развития макрофагов цАМФ ингибирует M-CSF-индуцированную экспрессию ERK, демонстрируя отрицательную роль в активации / поляризации макрофагов (54).Наше исследование ясно демонстрирует, что цАМФ активирует не только CREB, но и ERK, которые играют важную роль в поляризации M2. Помимо CREB, мы также обнаружили, что другие члены этого семейства факторов транскрипции, индуцированных цАМФ, такие как ATF3, активируются в макрофагах M2, обработанных IL-4. Довольно интересно, что форсколин в семь раз подавляет ATF3, как показано для макрофагов человека (55). Наши данные также продемонстрировали, что форсколин в пять раз подавлял ATF3 в макрофагах, происходящих от BM (данные не показаны).Таким образом, CREB и ATF3 регулируются форсколином противоположным образом. Это означает, что активация ATF3 в макрофагах M2, обработанных ингибиторами ERK, может происходить из-за компенсаторного механизма. В ЦНС активность ATF3 повышалась на ранних стадиях ЕАЭ на доклинической стадии, когда в ЦНС мигрировало небольшое количество инфильтрирующих лейкоцитов (56), что позволяет предположить, что ATF3, скорее всего, индуцировался в микроглиальных клетках, которые активируются до начала ЕАЭ (14). Таким образом, путь цАМФ имеет множественные действия в перекосе M2 макрофагов in vitro , действуя через множественные транскрипционные факторы, что требует дальнейшего изучения.

Механизмы, с помощью которых форсколин смещает макрофаги в сторону M2 in vivo во время EAE, даже сложны по сравнению с моделями in vitro , поскольку форсколин влияет на множество различных типов клеток. Макрофаги, как известно, имеют решающее значение для начала EAE (57), но это заболевание также инициируется аутоиммунными эффекторными клетками Th2 и Th27 (58). Было показано, что форсколин подавляет пролиферацию Т-клеток in vitro во время их праймирования, подавляя передачу сигналов IL-2 (23). В нашей модели мы начали введение форсколина в день начала заболевания (14-й день), когда форсколин воздействовал на уже примированные эффекторные клетки.Роль пути цАМФ более сложна в случае эффекторных Т-лимфоцитов CD4, поскольку существуют противоречивые исследования, демонстрирующие либо ингибирование, либо стимуляцию клеток Th2 и Th27 этим путем (6, 23, 59). Таким образом, существует вероятность того, что форсколин также способствует размножению Th2 и Th27 клеток in vivo во время EAE. Если это так, мы продемонстрировали, что прямое действие форсколина на макрофаги может преодолеть прямое воздействие на Т-клетки. Однако то, что форсколин делал с энцефалитогенными эффекторными CD4 T-клетками in vivo , оставалось загадкой, поскольку форсколин мог косвенно влиять на T-клетки, модулируя функцию антигенпрезентирующих клеток в ЦНС.Чтобы решить эту загадку, мы провели эксперимент in vitro , исследуя прямой эффект форсколина на пролиферацию примированной MOG-специфической обогащенной популяции CD4 + Vβ11 + Т-клеток. Наше исследование показало, что форсколин не оказывал значительного влияния на пролиферацию Т-лимфоцитов CD4, которые повторно стимулировались пептидом MOG. Такие же результаты мы получили при анализе MOG-специфической обогащенной популяции клеток CD4 + Vβ11 + : наблюдался сопоставимый уровень пролиферации.С другой стороны, мы подтвердили ранее опубликованные исследования о том, что во время поликлональной стимуляции Т-клеток анти-CD3 форсколин снижает пролиферацию Т-лимфоцитов CD4. Наши данные in vitro показывают, что MOG-специфические аутоиммунные CD4 Т-клетки не подвергались существенному влиянию форсколина. Таким образом, мы твердо убеждены, что маловероятно, что форсколин напрямую ингибирует эффекторные аутоиммунные Т-клетки CD4 во время ЕАЕ; скорее, форсколин влияет на макрофаги, что приводит к косвенному ингибированию энцефалитогенных Т-клеток в ЦНС.Поскольку форсколин не смещает баланс в сторону M2 на периферии (селезенка) и не оказывает прямого воздействия на аутоиммунные Т-клетки CD4, это, вероятно, объясняет, почему пролиферация и продукция IFNγ Т-лимфоцитами CD4 в селезенке не уменьшались под действием форсколина во время ЕАЕ. Мы полагаем, что форсколин повлиял на макрофаги в ЦНС, но не в селезенке, из-за наличия специфического микроокружения ЦНС, такого как присутствие внутреннего источника IL-4 в ЦНС (9). Действительно, наши данные показывают, что форсколин смещает макрофаги в сторону M2 в присутствии IL-4 или IL-4 и IFNγ.

Известно, что помимо макрофагов форсколин влияет на нейрональные клетки, активируя сигнальный путь BDNF – TrkB – CEBPβ. В нейронах ось CREB – CEBPβ ​​увеличивает выживаемость, репарацию и пластичность (59, 60). Наконец, форсколин может влиять на олигодендроциты и астроциты, повышая уровни цАМФ и / или ERK1 / 2 и способствуя их созреванию и дифференцировке (61–63). Мы обнаружили повышенное окрашивание LFB в спинном мозге мышей, получавших форсколин, по сравнению с необработанными (контрольными) мышами; это увеличение нельзя было объяснить артефактом окрашивания.Это говорит о том, что форсколин может улучшить миелинизацию во время выздоровления от EAE. Дальнейшие эксперименты установят другие клетки-мишени для этого препарата во время EAE / MS.

Взятые вместе, наши данные продемонстрировали новый ERK-зависимый механизм действия форсколина при перекосе макрофагов в сторону M2 in vitro и in vivo во время EAE. Наше исследование демонстрирует важную роль баланса M1 / ​​M2 в ЦНС для регуляции аутоиммунного воспаления и стимуляции патогенных Т-клеток, что имеет потенциальные применения для использования форсколина для терапии РС и других Th2-опосредованных аутоиммунных заболеваний.

Заявление об этике

Исследование было выполнено в соответствии с рекомендациями руководства ARRIVE (http://www.nc3rs.org.uk/arrive-guidelines). Все процедуры с животными проводились по индивидуальным лицензиям Министерства здравоохранения Гонконга и одобрены комитетом по этике животных Китайского университета Гонконга.

Авторские взносы

EP и телевидение задумали исследование. ТВ и ЕР разработали эксперименты. TV, AY, MD, IK, EP проводили эксперименты.NB и EP провели анализ данных проточной цитометрии. IP, AL и TS предоставили реагенты и материалы. TV, AY, IP, AL, TS, NB и EP проанализировали данные. Рукопись подготовили TV, IP, AL, TS, NB и EP.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим Бренду Чанг (Гарвардский университет) за помощь в подготовке рукописи.

Финансирование

Работа поддержана грантом Research Grant Council — Early Career Scheme, номер ссылки. 24100314 (Гонконг) и Российским проектом академического превосходства «5-100».

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу http://www.frontiersin.org/articles/10.3389/fimmu.2018.00050/full#supplementary-material.

Рисунок S1 . Влияние форсколина на активацию нижестоящих сигнальных путей CREB, CEBPβ ​​и ERK1 / 2 на исходном уровне макрофагов, происходящих из BM (контроль), или M2 (IL-4) vs.Условия поляризации M1 (IFNγ). Макрофаги, полученные из BM, выращивали в течение 5 дней в присутствии M-CSF и обрабатывали форсколином, или IL4, или IFNγ, или форсколином / IL4, или форсколином / IFNγ, или форсколином / IL4 / IFNγ в течение 10, 20 , и 30 мин. или на 24 ч. Ингибитор ERK U0126 использовали для блокирования фосфорилирования ERK1 и ERK2 (см. Материалы и методы). Экспрессии CREB, CEBPβ ​​и ERK1 / 2 и их фосфорилированных форм (p-CREB, p-CEBPβ ​​и p-ERK1 / 2) анализировали с помощью вестерн-блоттинга, как описано в разделе «Материалы и методы».Β-Актин использовался в качестве контроля нагрузки. Эту же очищенную мембрану использовали для оценки экспрессии всех белков, включая β-актин. Эти данные представляют три отдельных эксперимента (сокращения: I, IFNγ; 4, IL-4; F, форсколин; U, U0126).

Рисунок S2 . In silico анализ присутствия элементов цАМФ-ответа (CRE) в промоторных областях молекулы-предшественника микроРНК (miR) -124 pre-miR-124-3 и потенциальных факторов транскрипции, которые повышают экспрессию miR-124 в макрофагах. (A) Картирование элементов ответа на цАМФ в промоторной области 2000 п.н. перед молекулой-предшественником miR-124 pre-miR-124-3. Список факторов транскрипции, которые потенциально могут связывать сайты CRE, показан справа. Два выбранных фактора транскрипции CREB и активирующий фактор транскрипции (ATF) 3 отмечены красным. Сходные сайты CRE для связывания факторов транскрипции семейства CREB / ATF были также обнаружены для молекулы-предшественника pre-miR-124-2, но не для молекулы-предшественника pre-miR-124-1 (данные не показаны). (B) Промоторная область для pre-miR-124-3 с сайтами CRE показана для хромосомы 2 мыши и хромосомы 20 человека.

Рисунок S3 . Влияние активатора активирующего фактора транскрипции (ATF) 3 тауролидина на экспрессию микроРНК (miR) -124 в макрофагах, происходящих из костного мозга (BM). BM-макрофаги обрабатывали тауролидином в течение 24 часов, и экспрессию miR-124 анализировали, как описано в разделе «Материалы и методы». Показано среднее значение ± стандартная ошибка для трех экземпляров (** p <0,01).

Рисунок S4 . Роль RE1-сайленсирующего фактора транскрипции (REST) ​​в экспрессии микроРНК (miR) -124 в макрофагах.Макрофаги, полученные из костного мозга (BM), культивировали в течение 5 дней, как описано в разделе «Материалы и методы». Затем образцы, которые не были обработаны (контроль), обработаны форсколином (A, B) или обработаны ингибиторами REST (C, D) в течение указанных периодов, были проанализированы на экспрессию REST (A, B). или miR-124 (C, D). (A) Анализ экспрессии REST и REST4 в макрофагах, полученных из BM, на уровне мРНК с помощью RT-PCR. Макрофаги, происходящие из BM, анализировали как необработанные (контроль) или обработанные форсколином (FSK) в течение 2–4 часов.Первичные корковые нейроны мыши (Neu) использовали в качестве контроля с низким уровнем экспрессии REST и REST4. Отрицательный контроль (Neg) был средой. MW обозначают маркер молекулярной массы (в п.о.). Управление загрузкой GADPH показано ниже. (B) Анализ модуляции экспрессии REST в макрофагах, происходящих из BM, которые не обрабатывались в течение 4 или 24 часов или обрабатывались форсколином в течение 4 или 24 часов. Выражения REST анализировали с помощью вестерн-блоттинга, как описано в разделе «Материалы и методы». Актин использовался в качестве контроля нагрузки.Типичное изображение показано слева, количественный анализ экспрессии REST-нормализованного до -актина показан справа. Показано среднее значение ± стандартная ошибка трех отдельных экспериментов. (C) Макрофаги, происходящие из BM, инкубировали с ингибитором REST X5050 в течение 6 или 16 часов (в течение ночи), после чего экспрессию miR-124 оценивали с помощью ОТ-ПЦР в реальном времени, как описано в разделе «Материалы и методы». ” (D) Макрофаги, происходящие из BM, инкубировали с дцРНК NRSE, ингибирующей REST, в течение 16 часов, после чего экспрессию miR-124 оценивали с помощью ОТ-ПЦР в реальном времени, как описано в разделе «Материалы и методы».Ингибирование REST дцРНК NRSE приводило к 1,5-кратной активации miR-124. Показано среднее значение ± стандартная ошибка для трех экземпляров (* p <0,05).

Сокращения

Arg, аргиназа; ATF, активирующий фактор транскрипции; BM — костный мозг; ЦНС, центральная нервная система; CRE, элементы ответа cAMP; EAE, экспериментальный аутоиммунный энцефаломиелит; ЛФБ, люксол фаст синий; MOG, гликопротеин миелиновых олигодендроцитов; Mrc, рецептор маннозы; miR, микроРНК; Рассеянный склероз; NOS, синтетаза оксида азота; REST, фактор транскрипции, подавляющий RE1.

Список литературы

1. Вехби В.Л., Таскен К. Молекулярные механизмы цАМФ-опосредованной иммунорегуляции в Т-клетках — роль заякоренных сигнальных единиц протеинкиназы А. Front Immunol (2016) 7: 222. DOI: 10.3389 / fimmu.2016.00222

PubMed Аннотация | CrossRef Полный текст | Google Scholar

2. Мудоз Э., Зубяга А.М., Мерроу М., Заутер Н.П., Хубер Б.Т. Токсин холеры различает Т-хелперы 1 и 2 в активации, опосредованной рецептором Т-клеток: роль цАМФ в пролиферации Т-клеток. J Exp Med (1990) 172: 95–103. DOI: 10.1084 / jem.172.1.95

PubMed Аннотация | CrossRef Полный текст | Google Scholar

3. Датта С.К., Сабет М., Нгуен КПЛ, Вальдес П.А., Гонсалес-Навахас Дж. М., Ислам С. и др. Адъювантная активность токсина холеры на слизистых оболочках требует наличия клеток Th27 и защищает от ингаляционной формы сибирской язвы. Proc Natl Acad Sci U S. A (2010) 107: 10638–43. DOI: 10.1073 / pnas.1002348107

PubMed Аннотация | CrossRef Полный текст | Google Scholar

4.Mangmool S, Kurose H. Gi / o белковые и независимые действия токсина коклюша (ptx). Токсины (Базель) (2011) 3: 884–99. DOI: 10.3390 / токсины3070884

CrossRef Полный текст | Google Scholar

5. Вакацуки А., Заимствование П., Ригли К., Беверли, PCL. Связанный с клеточной поверхностью токсин коклюша вызывает поликлональные Т-клеточные ответы с высокими уровнями интерферона-γ в отсутствие интерлейкина-12. Eur J Immunol (2003) 33: 1859–68. DOI: 10.1002 / eji.200323675

CrossRef Полный текст | Google Scholar

6.Ли X, Мюррей Ф., Коиде Н., Голдстоун Дж., Данн С.М., Чен Дж. И др. Дивергентная потребность в Gαs и цАМФ в дифференцировке и воспалительном профиле различных подмножеств Th мыши. Дж. Клин Инвест (2012) 122: 963–73. DOI: 10.1172 / JCI59097

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Пономарев Э.Д., Марес К., Тан Ю., Диттель Б.Н. Полученный из ЦНС интерлейкин-4 необходим для регуляции аутоиммунного воспаления и вызывает состояние альтернативной активации в микроглиальных клетках. J Neurosci (2007) 27: 10714–21. DOI: 10.1523 / JNEUROSCI.1922-07.2007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

10. Пономарев Е.Д., Веремейко Т., Бартенева Н., Кричевский А.М., Вайнер Х.Л. MicroRNA-124 способствует покою микроглии и подавляет EAE, дезактивируя макрофаги через путь C / EBP-α-PU.1. Nat Med (2011) 17: 64–70. DOI: 10,1038 / нм.2266

PubMed Аннотация | CrossRef Полный текст | Google Scholar

11. Пономарев Э.Д., Веремейко Т, Вайнер Х.Л.МикроРНК являются универсальными регуляторами дифференцировки, активации и поляризации микроглии и макрофагов в нормальной и больной ЦНС. Glia (2013) 61: 91–103. DOI: 10.1002 / glia.22363

PubMed Аннотация | CrossRef Полный текст | Google Scholar

12. Старосом С.С., Веремейко Т., Юнг AWY, Духинова М., Au C, Lau AY, et al. Тромбоциты играют различную роль в инициации и прогрессировании аутоиммунного нейровоспаления. Circ Res (2015) 117: 779–92.DOI: 10.1161 / CIRCRESAHA.115.306847

PubMed Аннотация | CrossRef Полный текст | Google Scholar

13. Пономарев Е.Д., Шрайвер Л.П., Марес К., Педрас-Васконселос Дж., Вертели Д., Диттель Б.Н. Производство GM-CSF аутореактивными Т-клетками необходимо для активации микроглиальных клеток и начала экспериментального аутоиммунного энцефаломиелита. J Immunol (2007) 178: 39–48. DOI: 10.4049 / jimmunol.178.1.39

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14.Пономарев Э.Д., Шрайвер Л.П., Марес К., Диттель Б.Н. Активация и пролиферация микроглиальных клеток предшествует возникновению аутоиммунитета ЦНС. J Neurosci Res (2005) 81: 374–89. DOI: 10.1002 / jnr.20488

PubMed Аннотация | CrossRef Полный текст | Google Scholar

17. Веремейко Т, Сиддики С, Сотников И, Юнг А, Пономарев ЭД. IL-4 / IL-13-зависимая и независимая экспрессия miR-124 и ее вклад в фенотип M2 моноцитарных клеток в нормальных условиях и во время аллергического воспаления. PLoS One (2013) 8: e81774. DOI: 10.1371 / journal.pone.0081774

PubMed Аннотация | CrossRef Полный текст | Google Scholar

18. Сапио Л., Галло М., Иллиано М., Киози Е., Навильо Д., Спина А. и др. Форсколин, усиливающий естественный рост цАМФ, в терапии рака: пора ли? J Cell Physiol (2017) 232: 922–7. DOI: 10.1002 / jcp.25650

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19. Кувабара Т., Се Дж., Накашима К., Тайра К., Гейдж Ф. Х.Небольшая модуляторная дцРНК определяет судьбу взрослых нервных стволовых клеток. Cell (2004) 116: 779–93. DOI: 10.1016 / S0092-8674 (04) 00248-X

PubMed Аннотация | CrossRef Полный текст | Google Scholar

20. Фоллин-Арбелет В., Хофгаард П.О., Хоглин Х., Надери С., Сундан А., Бломхофф Р. и др. Циклический АМФ индуцирует апоптоз в клетках множественной миеломы и подавляет развитие опухоли на модели миеломы мышей. BMC Cancer (2011) 11: 301. DOI: 10.1186 / 1471-2407-11-301

PubMed Аннотация | CrossRef Полный текст | Google Scholar

21.Веремейко Т, Старосом С.С., Вайнер Х.Л., Пономарев ЭД. Обнаружение микроРНК в микроглии с помощью ПЦР в реальном времени в нормальной ЦНС и при нейровоспалении. J Vis Exp (2012) 65: e4097. DOI: 10,3791 / 4097

PubMed Аннотация | CrossRef Полный текст | Google Scholar

22. Сотников И, Веремейко Т, Старосом С.С., Бартенева Н, Вайнер Х.Л., Пономарев Э.Д. Тромбоциты распознают специфические для мозга гликолипидные структуры, реагируют на нервно-сосудистое повреждение и способствуют нейровоспалению. PLoS One (2013) 8: e58979.DOI: 10.1371 / journal.pone.0058979

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Родригес Дж., Росс Дж. А., Надь З. С., Киркен Р. А.. Форсколин-индуцируемый путь цАМФ отрицательно регулирует пролиферацию Т-клеток за счет разобщения рецепторного комплекса интерлейкина-2. J Biol Chem (2013) 288: 7137–46. DOI: 10.1074 / jbc.M112.408765

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24. Луан Б., Юн Й-С, Ле Лей Дж., Кестнер К. Х., Хедрик С., Монмини М.Путь CREB связывает передачу сигналов PGE2 с поляризацией макрофагов. Proc Natl Acad Sci U S A (2015) 112: 201519644. DOI: 10.1073 / pnas.1519644112

PubMed Аннотация | CrossRef Полный текст | Google Scholar

25. Монтеро Дж., Гомес-Абеллан В., Аризкун М., Мулеро В., Сепулькр М.П. Простагландин E2 способствует поляризации макрофагов M2 через сигнальный путь цАМФ / CREB и дезактивирует гранулоциты костистых рыб. Fish Shellfish Immunol (2016) 55: 632–41. DOI: 10.1016 / j.fsi.2016.06.044

PubMed Аннотация | CrossRef Полный текст | Google Scholar

26. Ху Дж., Рой С.К., Шапиро П.С., Родиг С.Р., Редди СПМ, Платаниас Л.К. и др. ERK1 и ERK2 активируют транскрипцию CCAAAT / β-зависимого белка, связывающего энхансер, в ответ на интерферон-γ. J Biol Chem (2001) 276: 287–97. DOI: 10.1074 / jbc.M004885200

CrossRef Полный текст | Google Scholar

27. Горгони Б., Маритано Д., Мартин П., Риги М., Поли В. Инактивация бета-гена C / EBP вызывает как нарушение, так и усиление экспрессии генов и обратную регуляцию мРНК IL-12 p40 и p35 в макрофагах. J Immunol (2002) 168: 4055–62. DOI: 10.4049 / jimmunol.168.8.4055

PubMed Аннотация | CrossRef Полный текст | Google Scholar

28. Руффелл Д., Муркиоти Ф., Гамбарделла А., Кирстеттер П., Лопес Р.Г., Розенталь Н. и др. Каскад CREB-C / EBP индуцирует экспрессию генов, специфичных для макрофагов M2, и способствует восстановлению мышечных повреждений. Proc Natl Acad Sci U S A (2009) 106: 17475–80. DOI: 10.1073 / pnas.01106

CrossRef Полный текст | Google Scholar

29.Кан Х, Чжан Дж., Ван Б., Лю М., Чжао Дж., Ян М. и др. Пуэрарин ингибирует поляризацию M2 и метастазирование ассоциированных с опухолью макрофагов из модели ксенотрансплантата NSCLC посредством инактивации пути MEK / ERK 1/2. Int J Oncol (2017) 50: 545–54. DOI: 10.3892 / ijo.2017.3841

PubMed Аннотация | CrossRef Полный текст | Google Scholar

30. Чжан Ю., Чокси С., Чен К., Побезинская Ю., Линнойла И., Лю З.Г. АФК играют решающую роль в дифференцировке альтернативно активируемых макрофагов и возникновении связанных с опухолью макрофагов. Cell Res (2013) 23: 898–914. DOI: 10.1038 / cr.2013.75

PubMed Аннотация | CrossRef Полный текст | Google Scholar

31. Чжоу И, Чжан Т., Ван Х, Вэй Х, Чен И, Го Л. и др. Куркумин модулирует поляризацию макрофагов за счет ингибирования экспрессии toll-подобного рецептора 4 и его сигнальных путей. Cell Physiol Biochem (2015) 36: 631–41. DOI: 10.1159 / 000430126

PubMed Аннотация | CrossRef Полный текст | Google Scholar

32.Ли MKS, Мур X-L, Fu Y, Al-Sharea A, Dragoljevic D, Fernandez-Rojo MA, et al. Липопротеин высокой плотности подавляет поляризацию макрофагов M1 человека за счет перераспределения кавеолина-1. Br J Pharmacol (2016) 173: 741–51. DOI: 10.1111 / bph.13319

PubMed Аннотация | CrossRef Полный текст | Google Scholar

33. Дуан В., Чан Дж. Х. П., Вонг Ч., Леунг Б. П., Вонг ВСФ. Противовоспалительные эффекты митоген-активированного ингибитора киназы протеинкиназы U0126 на модели астмы у мышей. J Immunol (2004) 172: 7053–9.DOI: 10.4049 / jimmunol.172.11.7053

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34. Дженкинс С.Дж., Рукерл Д., Кук П.С., Джонс Л.Х., Финкельман Ф.Д., ван Ройен Н. и др. Локальная пролиферация макрофагов, а не рекрутирование из крови, является признаком воспаления Th3. Science (2011) 332: 1284–8. DOI: 10.1126 / science.1204351

PubMed Аннотация | CrossRef Полный текст | Google Scholar

35. Jenkins SJ, Ruckerl D, Thomas GD, Hewitson JP, Duncan S, Brombacher F, et al.IL-4 напрямую сигнализирует резидентным в ткани макрофагам о том, что они должны разрастаться за пределы гомеостатических уровней, контролируемых CSF-1. J Exp Med (2013) 210: 2477–91. DOI: 10.1084 / jem.20121999

PubMed Аннотация | CrossRef Полный текст | Google Scholar

37. Ричардсон Е.Т., Шукла С., Надь Н., Бум WH, Бек Р.К., Чжоу Л. и др. Передача сигналов ERK важна для развития макрофагов. PLoS One (2015) 10: e0140064. DOI: 10.1371 / journal.pone.0140064

PubMed Аннотация | CrossRef Полный текст | Google Scholar

38.Лабзин Л.И., Шмидт С.В., Мастерс С.Л., Бейер М., Кребс В., Клее К. и др. ATF3 является ключевым регулятором ответа макрофагов на IFN. J Immunol (2015) 195: 4446–55. DOI: 10.4049 / jimmunol.1500204

PubMed Аннотация | CrossRef Полный текст | Google Scholar

39. Мюллер С., Сматлик Н., Буриан М., Горески К., Рекен М., Язди А.С. Дифференциальная индукция ATF3 и HO-1 в миелоидных клетках и кератиноцитах с помощью диметилфумарата или циклоспорина A. J Dermatol Sci (2017) 87: 246–51.DOI: 10.1016 / j.jdermsci.2017.06.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

40. Даргахи Н., Катсара М., Целиос Т., Андроутсу М.Э., Де Куртен М., Мацукас Дж. И др. Рассеянный склероз: обновленная иммунопатология и методы лечения. Brain Sci (2017) 7:78. DOI: 10.3390 / brainsci7070078

CrossRef Полный текст | Google Scholar

41. Инь Икс, Вольффорд С.К., Чанг И.С., МакКоноуги С.Дж., Рэмси С.А., Адерем А. и др. ATF3, ген адаптивного ответа, усиливает передачу сигналов TGF и функции клеток, инициирующих рак в клетках рака груди. J Cell Sci (2010) 123: 3558–65. DOI: 10.1242 / jcs.064915

CrossRef Полный текст | Google Scholar

42. Гонг Д., Ши В., Йи С., Чен Х., Гроффен Дж., Хейстеркамп Н. Передача сигналов TGFβ играет решающую роль в стимулировании альтернативной активации макрофагов. BMC Immunol (2012) 13:31. DOI: 10.1186 / 1471-2172-13-31

CrossRef Полный текст | Google Scholar

43. Hu C, Meng X, Huang C, Shen C, Li J. Передовая наука: ATF3 отвечает за ингибирование высвобождения TNF-a и нарушение миграции моноцитов и макрофагов, подвергшихся острому воздействию этанола. J Leukoc Biol (2015) 9: 0–0. DOI: 10.1189 / jlb.2HI1115-491R

CrossRef Полный текст | Google Scholar

44. Хромик А.М., Хан С.А., Дайгелер А., Флиер А., Булут Д., Мэй С. и др. Анализ экспрессии генов индукции гибели клеток тауролидином в различных линиях злокачественных клеток. BMC Cancer (2010) 10: 595. DOI: 10.1186 / 1471-2407-10-595

PubMed Аннотация | CrossRef Полный текст | Google Scholar

45. Конако С., Отто С., Хан Дж. Дж., Мандель Г. Взаимные действия REST и микроРНК способствуют идентичности нейронов. Proc Natl Acad Sci U S A (2006) 103: 2422–7. DOI: 10.1073 / pnas.0511041103

PubMed Аннотация | CrossRef Полный текст | Google Scholar

46. Су Н, Ли Й, Ван Дж, Фан Дж, Ли Х, Пэн В. и др. Роль сигнальных путей MAPK в процессе дифференцировки макрофагов M2, индуцированных высоким содержанием глюкозы в окружающей среде и TGF-β1. J Recept Signal Transduct Res (2015) 35: 396–401. DOI: 10.3109 / 10799893.2014.960933

PubMed Аннотация | CrossRef Полный текст | Google Scholar

47.Мебрату Ю., Тесфайгзи Ю. Как активация ERK1 / 2 контролирует пролиферацию клеток и гибель клеток — ответ на вопрос субклеточной локализации? Cell Cycle (2009) 8: 1168–75. DOI: 10.4161 / cc.8.8.8147

PubMed Аннотация | CrossRef Полный текст | Google Scholar

48. Misra UK, Pizzo SV. Координированная регуляция индуцированной форсколином клеточной пролиферации в макрофагах с помощью протеинкиназы A / белка, связывающего элемент цАМФ (CREB) и передачи сигналов Epac1-Rap1: эффекты подавления экспрессии гена CREB на активацию Akt. J Biol Chem (2005) 280: 38276–89. DOI: 10.1074 / jbc.M507332200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

49. Биркнер К., Вассер Б., Лоос Дж., Плотников А., Сегер Р., Зипп Ф. и др. Роль передачи сигналов ERK в экспериментальном аутоиммунном энцефаломиелите. Int J Mol Sci (2017) 18: 1990. DOI: 10.3390 / ijms180

CrossRef Полный текст | Google Scholar

50. Jaguin M, Houlbert N, Fardel O, Lecureur V. Профили поляризации человеческих M-CSF-генерируемых макрофагов и сравнение M1-маркеров в классически активированных макрофагах из GM-CSF и M-CSF происхождения. Cell Immunol (2013) 281: 51–61. DOI: 10.1016 / j.cellimm.2013.01.010

PubMed Аннотация | CrossRef Полный текст | Google Scholar

51. Brereton CF, Sutton CE, Lalor SJ, Lavelle EC, Mills KHG. Ингибирование ERK MAPK подавляет продукцию IL-17, управляемую IL-23 и IL-1, и ослабляет аутоиммунное заболевание. J Immunol (2009) 183: 1715–23. DOI: 10.4049 / jimmunol.0803851

PubMed Аннотация | CrossRef Полный текст | Google Scholar

52. Чанг С.Ф., Д’Суза, В.Н., Чен, Иллинойс, Пейджер, Дж. Пуиссегур, С.М. Хедрик.Полярные противоположности: направление Erk субпопуляций Т-лимфоцитов CD4. J Immunol (2012) 189: 721–31. DOI: 10.4049 / jimmunol.1103015

PubMed Аннотация | CrossRef Полный текст | Google Scholar

53. Моррис С.М., Кепка-Ленхарт М., Полякович А., Гош К.Е., Шелдон Х., Шандилья Д. и др. Промотор аргиназы I активирует IL-4 и циклический AMP, синергетически формируя фенотип макрофагов мыши: формируя фенотип макрофагов мыши: IL-4 и циклический AMP синергетически активируют промотор аргиназы I. J Immunol (2013) 191: 2290–8. DOI: 10.4049 / jimmunol.1202102

CrossRef Полный текст | Google Scholar

54. Zhu N, Cui J, Qiao C, Li Y, Ma Y, Zhang J, et al. CAMP модулирует развитие макрофагов, подавляя активацию MAPK, индуцированную M-CSF. Cell Mol Immunol (2008) 5: 153–7. DOI: 10,1038 / cmi.2008.19

PubMed Аннотация | CrossRef Полный текст | Google Scholar

55. Герц А.Л., Бендер А.Т., Смит К.С., Гилкрист М., Амье П.С., Адерем А. и др.Повышенное ингибирование циклического AMP и PDE4 вызывает экспрессию хемокинов в макрофагах, происходящих из моноцитов человека. Proc Natl Acad Sci U S A (2009) 106: 21978–83. DOI: 10.1073 / pnas.04106

PubMed Аннотация | CrossRef Полный текст | Google Scholar

56. Фрезель Н., Сохет Ф., Данеман Р., Басбаум А.И., Браз Дж. М.. ATF3 периферических и центральных нейронов предшествует инфильтрации CD4 + Т-лимфоцитами при EAE. Exp Neurol (2016) 283: 224–34. DOI: 10.1016 / j.expneurol.2016.06.019

CrossRef Полный текст | Google Scholar

57.Аджами Б., Беннетт Дж. Л., Кригер К., МакНагни К. М., Росси FMV. Проникающие моноциты вызывают прогрессирование EAE, но не вносят вклад в резидентный пул микроглии. Nat Neurosci (2011) 14: 1142–50. DOI: 10.1038 / nn.2887

PubMed Аннотация | CrossRef Полный текст | Google Scholar

58. Пономарев Э.Д., Шрайвер Л.П., Диттель Б.Н. Экспрессия CD40 микроглиальными клетками необходима для завершения двухэтапного процесса активации во время аутоиммунного воспаления центральной нервной системы. J Immunol (2006) 176: 1402–10. DOI: 10.4049 / jimmunol.176.3.1402

PubMed Аннотация | CrossRef Полный текст | Google Scholar

59. Ма TC, Barco A, Ratan RR, Willis DE. ЦАМФ-чувствительный элемент-связывающий белок (CREB) и цАМФ совместно регулируют зависимую от активаторного белка 1 (AP1) экспрессию гена, связанную с регенерацией, и рост нейритов. J Biol Chem (2014) 289: 32914-25. DOI: 10.1074 / jbc.M114.582460

PubMed Аннотация | CrossRef Полный текст | Google Scholar

60.Kellner Y, Gödecke N, Dierkes T, Thieme N, Zagrebelsky M, Korte M. Эффекты BDNF на дендритные шипы зрелых нейронов гиппокампа зависят от активности нейронов. Front Synaptic Neurosci (2014) 6: 5. DOI: 10.3389 / fnsyn.2014.00005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

61. Афшари Ф.С., Чу А.К., Сато-Бигби С. Влияние циклического АМФ на экспрессию видов основных белков миелина и протеолипидного белка миелина в коммитированных олигодендроцитах: дифференциальное участие фактора транскрипции CREB. J Neurosci Res (2001) 66: 37–45. DOI: 10.1002 / jnr.1195

PubMed Аннотация | CrossRef Полный текст | Google Scholar

62. Пако С., Хаммель М., Пла В., Сумой Л., Агуадо Ф. Циклическая передача сигналов АМФ ограничивает активацию и способствует созреванию и антиоксидантной защите астроцитов. BMC Genomics (2016) 17: 304. DOI: 10.1186 / s12864-016-2623-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

63. Исии А., Фурушо М., Бансал Р. Устойчивая активация ERK1 / 2 MAPK в олигодендроцитах и ​​шванновских клетках усиливает рост миелина и стимулирует размножение предшественников олигодендроцитов. J Neurosci (2013) 33: 175–86. DOI: 10.1523 / JNEUROSCI.4403-12.2013

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Терапевтическое значение при муковисцидозе носовых пазух

Int Forum Allergy Rhinol. Авторская рукопись; доступно в PMC 2020 1 января.

Опубликован в окончательной редакции как:

PMCID: PMC6318032

NIHMSID: NIHMS984861

, MD, 1, 2 , PhD, 1, 2 2 2 2 PhD, DrSc, 2, 3 , MD, 1 , BS, 1 , BS, 1, 2 , PhD, 1, 2 , BS, 1, 2 , 1 , PhD, DrSc, 2, 3 and, MD 1, 2

Do-Yeon Cho

1 Кафедра отоларингологии, Университет Алабамы,

, Бирмингем, 9 2 Исследовательский центр кистозного фиброза имени Грегори Флеминга Джеймса, Университет Алабамы в Бирмингеме

Шаоян Чжан

1 Кафедра отоларингологии, Университет Алабамы в Бирмингеме

2 Исследовательский центр Университета Грегори Флеминга Джеймса в Алабаме. в Бирмингеме 9 0015

Ахмед Лазрак

2 Исследовательский центр муковисцидоза имени Грегори Флеминга Джеймса, Университет Алабамы в Бирмингеме

3 Отделение анестезиологии и периоперационной медицины, Университет Алабамы в Бирмингеме

Джессика В.Grayson

1 Кафедра отоларингологии Университета Алабамы в Бирмингеме

Хайме А. Пенья Гарсия

1 Кафедра отоларингологии Университета Алабамы в Бирмингеме

Дэниел Ф. Скиннерология

1

, Университет Алабамы в Бирмингеме

2 Исследовательский центр кистозного фиброза Грегори Флеминга Джеймса, Университет Алабамы в Бирмингеме

Донг Джин Лим

1 Кафедра отоларингологии Университета Алабамы в Бирмингеме

2 0006
Флеминг Исследовательский центр кистозного фиброза Джеймса, Университет Алабамы в Бирмингеме

Calvin Mackey

1 Кафедра отоларингологии, Университет Алабамы в Бирмингеме

2 Грегори Флеминг Исследовательский центр кистозного фиброза Джеймса, Университет Кирминг70, Алабама, 905 Банки

9000 5 1 Отделение отоларингологии, Университет Алабамы в Бирмингеме

Садис Маталон

2 Исследовательский центр кистозного фиброза имени Грегори Флеминга Джеймса, Университет Алабамы в Бирмингеме

3 Отделение анестезиологии и периооперационной медицины Университета Алабамы Бирмингем

Брэдфорд А.Woodworth

1 Кафедра отоларингологии, Университет Алабамы в Бирмингеме

2 Исследовательский центр кистозного фиброза имени Грегори Флеминга Джеймса, Университет Алабамы в Бирмингеме

1 Кафедра отоларингологии

0005, Бирмингемский университет

2 Исследовательский центр муковисцидоза имени Грегори Флеминга Джеймса, Университет Алабамы в Бирмингеме

3 Кафедра анестезиологии и периоперационной медицины, Университет Алабамы в Бирмингеме

Автор для корреспонденции : Брэдфорд А.Вудворт, доктор медицины, FACS, профессор отоларингологии Джеймса Дж. Хикса, директор программы резидентуры, Университет Алабамы в Бирмингеме, младший научный сотрудник, Центр исследования кистозного фиброза Грегори Флеминга Джеймса, p: 205.934.9777, f: 205.934.3993, ude.cmbau @htrowdoowb, все запросы на перепечатку обращайтесь к этому автору. См. другие статьи в PMC, в которых цитируется опубликованная статья.

Abstract

ВВЕДЕНИЕ:

Мутации в гене регулятора трансмембранной проводимости при муковисцидозе (CFTR) приводят к нарушению транспорта Cl и вызывают хронические бактериальные инфекции в верхних и нижних дыхательных путях пациентов с муковисцидозом (CF).Ивакафтор представляет собой усилитель CFTR, который улучшает транспорт Cl у пациентов с МВ, по крайней мере, с одной копией мутации G551D. Ресвератрол также является мощным усилителем CFTR, который увеличивает детерминанты мукоцилиарного транспорта. Цель этого исследования — оценить, улучшают ли ресвератрол и ивакафтор секрецию Cl в G551D CFTR по сравнению с одним из этих агентов.

МЕТОДЫ:

Клетки щитовидной железы крысы Fisher (FRT), трансфицированные G551D CFTR, и человеческие эпителиальные клетки носовых пазух (HSNE), содержащие мутацию CFTR G551D, подвергали фармакологическим манипуляциям с трансэпителиальным переносом ионов в камерах Уссинга.Активность дополнительно оценивали с использованием способов фиксации целых клеток в клетках G551D FRT.

РЕЗУЛЬТАТЫ:

В клетках FRT-G551D ресвератрол (100 мкМ) и ивакафтор (10 мкМ) значительно увеличили транспорт Cl (изменение тока короткого замыкания, ΔI SC = мкА / см 2 ) по сравнению с контролем с одним агентом и диметилсульфоксидом-носителем (ресвератрол + ивакафтор, 4,97 +/- 0,57 по сравнению с ивакафтором, 0,74 +/- 0,12 по сравнению с ресвератролом, 2,96 +/- 0,52 по сравнению с контролем, 0,74 +/- 0,12; p <0 .001). Максимальная секреция Cl (20 мкМ форсколина) также была значительно увеличена (p <0,0001). Активность была подтверждена в G551D HSNE (ресвератрол + ивакафтор, 4,48 +/- 0,39 против ивакафтора, 1,05 +/- 0,11 против ресвератрола, 0,84 +/- 0,3 против контроля, 0,0 +/- 0,02; p <0,001) и анализ цельноклеточного патч-зажима в клетках G551D FRT (ресвератрол + ивакафтор; -2535 +/- 179,3 пА по сравнению с ивакафтором; -1408,9 +/- 101,3 пА по сравнению с ресвератролом; -766,2 +/- 71,2 пА; p <0,0001).

ЗАКЛЮЧЕНИЕ:

Дополнительное улучшение секреции Cl , опосредованной G551D CFTR, предполагает, что ресвератрол может усилить терапию ивакафтором у этих пациентов и улучшить риносинусит, связанный с МВ.

Ключевые слова: муковисцидоз, МВТР, мукоцилиарный клиренс, мукоцилиарный транспорт, синусит, хронический синусит, хронический риносинусит, G551D, потенциатор CFTR, ресвератрол, ивакафтор

ВВЕДЕНИЕ

Муковисцидоз (МВ) является наиболее распространенным генетическим смертельным заболеванием. расстройства, которым страдает примерно 1 человек из 2500 европеоидной расы ежегодно. 1 Это мультисистемное заболевание, вызванное мутациями в гене регулятора трансмембранной проводимости муковисцидоза (CFTR), характеризуется дефектным транспортом анионов хлорида (Cl ) и бикарбоната через секреторный эпителий, что приводит к аномально вязким выделениям в дыхательные пути и другие системы органов. 1 Секреции в дыхательных путях обычно служат для улавливания и удаления посторонних материалов через мукоцилиарный клиренс (MCC). Этот механизм широко считается основной врожденной защитой дыхательных путей от бактериальных инфекций. Наиболее распространенной генетической мутацией является F508del CFTR, при которой неправильная укладка и обработка белка в эпителиальных клетках приводит к неэффективной секреции анионов. В G551D CFTR нормальное количество каналов CFTR присутствует в плазматической мембране, но вероятность открытия (Po) открытия канала сильно снижается.Люди с уплотненной слизью подвергаются повышенному риску нарушения МКК и хронических рецидивирующих бактериальных инфекций верхних и нижних дыхательных путей, включая тяжелый хронический риносинусит (ХРС). 2

Ивакафтор (Vertex phamaceuticals, Бостон, Массачусетс) — это потенциатор каналов CFTR, одобренный для лечения пациентов с МВ, по крайней мере, с одной копией мутации G551D, и теперь расширенный для использования у пациентов с другим классом III (проблемы с каналом gating) и мутации остаточной функции. 2,3 Механически ивакафтор представляет собой неселективный потенциатор, поскольку он увеличивает Po в канале CFTR дикого типа и различных форм мутированного CFTR (например, G551D, F508del) в присутствии фосфорилирования регуляторного домена CFTR (R-D). 3 Это лучше всего продемонстрировано in vitro после активации цАМФ / протеинкиназы A (PKA) -зависимых путей лекарствами, такими как форсколин, которые фосфорилируют R-D. 4 Было показано, что ивакафтор усиливает конечные точки, позволяющие прогнозировать пользу у пациентов с G551D CF, включая MCC, Cl в поту и функцию легких. 2 Хотя препарат не нормализует лежащую в основе патофизиологию, достигаемая частичная функция отражает результаты исследований in vivo , в которых коррелировали активность CFTR у пациентов с МВ с тяжестью заболевания. Лица, демонстрирующие 10–25% активности CFTR, наблюдаемой у лиц, не страдающих МВ, имеют менее тяжелое заболевание в зависимости от возраста постановки диагноза, функции легких и функции поджелудочной железы, чем лица, у которых активность CFTR не обнаруживается. 5–7 Таким образом, увеличение активности G551D CFTR путем комбинации ивакафтора с другими потенциаторами должно принести дополнительную пользу с большей нормализацией основного электролитного дисбаланса, ответственного за клинический фенотип заболевания.Важно отметить, что та же стратегия, применяемая для активации секреции Cl в нижних дыхательных путях пациентов с МВ, также применима для очистки носовых пазух и слизи при МВ-ассоциированном СВК, который почти универсален в этой популяции. 8

Одной молекулой-кандидатом для дальнейшего усиления G551D CFTR является ресвератрол, который также был идентифицирован как мощный усилитель CFTR дикого типа и улучшает детерминанты мукоцилиарного транспорта. 4 Ресвератрол аналогичен по структуре молекулам флавоноидов, таким как генистеин, которые обладают способностью активировать CFTR Po, 9–11 и могут напрямую связываться с CFTR, возможно, на границе раздела между двумя нуклеотидсвязывающими доменами (NBD). . 12,13 Ряд потенциаторов CFTR, вероятно, имеют общий механизм действия или сайт связывания, поскольку не наблюдается аддитивного эффекта, когда они объединяются для измерения функции CFTR in vitro (например, генистеин и NS004). 14,15 Однако некоторые агенты явно проявляют аддитивный эффект (например, UCCF-029 и UCCF-853, 15 генистеин и куркумин 16 ). Опосредует ли ресвератрол потенцирование каналов CFTR по такому же механизму действия, что и ивакафтор, в настоящее время неизвестно.

Целью данного исследования является оценка того, улучшает ли комбинированное применение ресвератрола и ивакафтора G551D CFTR-опосредованную секрецию Cl по сравнению с любым из этих агентов по отдельности.

МАТЕРИАЛЫ И МЕТОДЫ

Культура клеток

До начала исследования было получено одобрение Институционального наблюдательного совета от Университета Алабамы в Бирмингеме. Ткань носовых пазух человека была взята у одного пациента с МВ с генотипом G551D / F508del, перенесшего операцию на носовых пазухах.Клетки диссоциировали и выращивали на проницаемых фильтрующих опорах диаметром 6,5 мм, погруженных в культуральную среду, как описано ранее. 17–24 Среду удаляли из монослоев на 4-й день после достижения слияния, и клетки подавали через базальную камеру. Культуры использовали после полной дифференцировки с широко распространенным цилиогенезом и трансэпителиальным сопротивлением> 300 Ом · см.

Клетки FRT (Fisher Rat Thyroid), экспрессирующие человеческий G551D CFTR, были предоставлены Исследовательским центром кистозного фиброза Грегори Флеминга Джеймса.кДНК, несущие человеческий G551D CFTR, вводили в клетки FRT с использованием системы Flp-in (Invitrogen, Grand Island, NY). Клетки FRT выращивали в среде, содержащей модифицированный Coon’s Ham’s F-12 с 5% FBS и 100 мкг / мл гигромицина. Клеточные среды заменяли каждые 48 часов. Для исследований в камере Уссинга 5 × 10 4 клеток FRT выращивали на вставках Transwell 6,5 мм (поры мембраны 0,4 мкм) в течение 5 дней. Апикальные и базолатеральные среды заменяли каждые 48 часов. Для исследований патч-зажима клетки FRT высевали на покровные стекла с очень низкой плотностью и использовали на следующий день.

Измерения в камере Уссинга

Вставки Transwell были помещены в камеры Уссинга для мониторинга транспорта ионов и фармакологической блокады, как описано ранее. 24 Апикальные монослои анализировали в условиях короткого замыкания после компенсации сопротивления жидкости автоматическими зажимами напряжения VCC 600 (Physiologic Instruments, Сан-Диего, Калифорния, США). Вставки помещали в раствор ванны при 37 ° C, состоящий из (мМ): 120 NaCl, 25 NaHCO3, 3,3 Kh3PO4, 0,8 K2HPO4, 1.2 MgCl2, 1,2 CaCl2 и 10 глюкозы с pH 7,3-7,4 в газированной смеси 95% O2: 5% CO2. Химические вещества были закуплены у Sigma Aldrich (Карлсбад, Калифорния). Все исследования проводились в ваннах для слизистых оболочек с низким Cl (6 мМ). Затем измерения тока короткого замыкания (I SC ) регистрировали со скоростью 1 образец в секунду, и, по соглашению, положительные отклонения указывали на чистое перемещение анионов от серозной к поверхности слизистой оболочки. Последовательное фармакологическое введение включало амилорид (ингибирует натриевые каналы) (100 мкМ), потенциатор CFTR [ивакафтор (10 мкМ), ресвератрол (100 мкМ) или ивакафтор 10 мкМ) + ресвератрол (100 мкМ)], форсколин (20 мкМ, фосфорилаты Регуляторный домен CFTR через цАМФ-зависимые механизмы) и CFTRinh-172 (10 мкМ, специфический ингибитор CFTR).

Пластырь-зажим для целых клеток

Стабильные клетки FRT, трансфицированные G551D-CFTR, на покровных стеклах переносили в экспериментальную камеру, установленную на столике микроскопа (Olympus). Токи G551D-CFTR регистрировали в режиме целой клетки с помощью метода фиксации патч-зажима с использованием усилителя Axopatch 2000B, подключенного к компьютеру через DIGITA 1440A. Данные записывали и анализировали с использованием программного обеспечения Pclamp (Molecular Devices). В ходе экспериментов клетки перфузировали внешним раствором следующего ионного состава (в мМ): 145 CsCl, 2 MgCl 2 , 2 Cacl 2 , 5.5 Глюкоза, 10 HEPES pH 7,4 (1 н. NaOH). Сопротивление пипетки, используемой для полной записи, составляло от 3 до 5 ГОм при заполнении следующим раствором внутрипипетки (в мМ): 135 CsCl, 10 KCl, 2 MgCl 2 , 0,1 EGTA, 5,5 глюкозы, 10 HEPES, pH 7,2 (1N КОН). Все эксперименты проводились при комнатной температуре. Клетки непрерывно перфузировали внешним раствором до развития регистрирующей конфигурации всей клетки. Форсколин, ивакафтор, ресвератрол и ивакафтор + ресвератрол применялись через ту же перфузионную систему.Скорость перфузии доводили до 1 мл / мин.

Статистический анализ

Используемый статистический анализ: двухфакторный дисперсионный анализ с апостериорным анализом Тьюки-Крамера. Все значения представлены как среднее ± стандартная ошибка среднего [SEM]. Статистически значимым считалось значение p <0,05.

РЕЗУЛЬТАТЫ

Ресвератрол и ивакафтор улучшают CFTR-опосредованную секрецию Cl

в клетках G551D FRT и G551D / F508del HSNE -ток цепи (ΔI SC = мкА / см 2 ).Поскольку первичные клетки HSNE непосредственно засеваются на фильтры после диссоциации из ткани для оптимизации фенотипа переноса ионов и дифференциации, ограниченное количество клеток доступно для тестирования. Таким образом, сначала был проведен анализ камеры Уссинга с использованием клеток G551D-FRT для оптимизации дозирования для экспериментов с HSNE. Ресвератрол начинает влиять на максимальную секреторную способность Cl в присутствии форсколина в дозах выше 100 мкМ (данные не показаны), и поэтому эта доза считается оптимальной. Ивакафтор также начинает препятствовать максимальной секреторной способности Cl при дозах выше 10 мкМ, и эта концентрация считалась подходящей в предыдущих исследованиях in vitro . 3 Клетки FRT лишены эпителиальных натриевых каналов (ENaC), и это было подтверждено отсутствием амилорид-чувствительного I SC . Хотя ΔI SC в целом был довольно низким, так как процент максимально активированного I SC с форсколином, ресвератролом и ивакафтором увеличивал перенос Cl по сравнению с одним ресвератролом или ивакафтором и средствами контроля (n≥8 на состояние; ресвератрол + ивакафтор, 4,97 +/- 0,57 по сравнению с ивакафтором, 0,74 +/- 0,12 по сравнению с ресвератролом, 2,96 +/- 0,52 по сравнению сконтроль 0,74 +/- 0,12; р <0,001). Что еще более важно, максимальная способность к векторному транспорту Cl через каналы CFTR была значительно улучшена с обоими агентами при применении форсколина (ресвератрол + ивакафтор, 254,5 +/- 7,53 по сравнению с ивакафтором, 217,61 +/- 8,27 по сравнению с ресвератролом, 148,2 +/- 8,28 по сравнению с ДМСО, 92,93 +/- 4,22; p <0,0001). Стимулированный форсколином ΔI SC клеток FRT G551D в присутствии 2 потенциаторов составлял приблизительно 60% от стимулированного форсколином ΔI SC , наблюдаемого в клетках FRT CFTR дикого типа (данные не показаны).Репрезентативные трассировки и сводные данные представлены в.

(A) Типичное отслеживание тока в камере Уссинга в клетках FRT G551D после последовательного введения амилорида, потенциатора (ов) и INH-172. (B) Сводка текущих измерений. Планки погрешностей представляют SEM. Все значения внутри групп достоверно отличаются друг от друга (потенциатор, p <0,001; потенциатор + форсколин, p <0,0001).

Аналогичная картина наблюдалась с первичными клетками HSNE G551D (), показывающими значительное улучшение с 2 потенциаторами (n≥5 на состояние; ресвератрол + ивакафтор, 4.48 +/- 0,39 против ивакафтора, 1,05 +/- 0,11 против ресвератрола, 0,84 +/- 0,3 против ДМСО, 0,0 +/- 0,02; р <0,001). Стимуляция CFTR-опосредованного I SC потенциаторами CFTR обычно была лучше с первичным HSNE в процентах от общего форсколин-стимулированного I SC . 25 Максимальная секреция Cl была увеличена с помощью обоих агентов (ресвератрол + ивакафтор, 32,2 +/- 1,17 по сравнению с ресвератролом, 10,73 +/- 0,84 по сравнению с ивакафтором, 21,29 +/- 0,85 по сравнению с ДМСО, 3,88 +/- 0,85; p <0,001) до уровней, соответствующих тому, что обнаруживается в HSNE без CF. 26–28

(A) Репрезентативные записи тока в камере Уссинга в клетках HSNE G551D / F508del после последовательного введения амилорида, потенциатора (ов) и INH-172. (B) Сводка текущих измерений. Планки погрешностей представляют SEM. Важные результаты отмечены звездочкой. Все значения внутри групп (потенциатор или потенциатор + форсколин) значительно отличаются друг от друга (p <0,001).

Комбинированные потенциаторы улучшают секрецию Cl

, опосредованную G551D CFTR, по данным анализа с помощью заплатки на целых клетках.

Токи фиксации на целых клетках подтвердили, что активность CFTR заметно усиливается при комбинированном применении ресвератрола и ивакафтора.Потенциаторы не активировали токи CFTR, когда форсколин отсутствовал. Это согласуется с предыдущими исследованиями, в которых использовались методы «патч-клэмп» для потенциаторов CFTR, которые требуют, по крайней мере, некоторого базового фосфорилирования R-D. 3 CFTR-опосредованные токи были заметно улучшены при совместном назначении ресвератрола и ивакафтора (-2535 +/- 179,3 пА) по сравнению с ивакафтором (-1408,9 +/- 101,3 пА) и только ресвератролом (-766,2 +/- 71,2 пА). (; р <0,0001). Метод «патч-зажим» лучше контролирует мембранный потенциал клетки и действительно показал, что ток, связанный с комбинированным применением (в присутствии форсколина), был немного больше, чем сумма отдельных токов от любого агента по отдельности..

(A) ВАХ проиллюстрированы во время активации тока Cl с форсколином и форсколином + потенциаторами, когда шаг напряжения изменялся от -100 мВ до 100 мВ с шагом 20 мВ в течение 500 мс. Потенциал клеточной мембраны поддерживался на уровне 0 мВ на протяжении всего эксперимента. (B) Сводные данные о токах при шаге напряжения -100 мВ и удерживающем потенциале 0 мВ. Все значения достоверно отличаются друг от друга (р <0,0001). (Форск = форсколин, Ива = ивакафтор, Ресв = Ресвератрол)

ОБСУЖДЕНИЕ

Для стробирующих мутаций класса 3, таких как G551D, комбинированная потенцирующая терапия имеет важное клиническое значение, поскольку они показывают чрезвычайно низкое Po. 29 В этом исследовании мы исследовали эффекты ивакафтора, ресвератрола и их совместного применения на G551D-CFTR и определили, что комбинация агентов значительно увеличивает CFTR-опосредованный транспорт Cl в клетках FRT и первичных клетках HSNE, экспрессирующих G551D CFTR. по сравнению с любым агентом в одиночку. Кроме того, когда R-домены были максимально фосфорилированы посредством цАМФ-зависимых путей с добавлением форсколина, общая способность секреции Cl также заметно улучшилась с обоими препаратами.Было установлено, что при оптимальной дозе ивакафтор (10 мкМ) более эффективен, чем ресвератрол (100 мкМ), в улучшении CFTR-опосредованного транспорта Cl (с помощью пластыря на целых клетках) и общей способности секреции Cl после применения. форсколина. Важно отметить, что ресвератрол и ивакафтор стимулировали значительно большую секрецию Cl через каналы G551D-CFTR, то есть активность канала G551D-CFTR, которая была максимально усилена при сочетании обоих препаратов, была сильнее, чем аддитивный эффект обоих агентов по отдельности.Подобные эффекты были выявлены как в FRT, так и в первичной HSNE. Таким образом, мы пришли к выводу, что ресвератрол и ивакафтор влияют на G551D-CFTR через разные, но, возможно, взаимодополняющие механизмы стробирования. Эффекты могут быть опосредованы повышенной эффективностью одного или обоих лекарств в их активном сайте связывания.

Ресвератрол и ивакафтор увеличивают токи CFTR дикого типа в вырезанных участках, и, таким образом, их мишень находится внутри самой молекулы CFTR. 3,30,31 Оба агента влияют на АТФ-зависимое закрытие каналов CFTR с увеличением Po в канале, что согласуется с целевым сайтом на димере NBD.Растущие данные свидетельствуют о том, что большинство потенциаторов CFTR действуют посредством связывания с NBD, чтобы способствовать активности белка, а затем, с более низким сродством, к ингибирующему сайту. 32 Таким образом, при более высоких дозах потенциаторы начинают подавлять способность к секреции Cl , опосредованной CFTR. Двухфазная зависимость доза-ответ для ресвератрола наблюдалась ранее с оптимально устойчивой CFTR-опосредованной секрецией анионов при 100 мкМ без изменения максимальной способности к секреции Cl (активируемой форсколином). 30,31 Было обнаружено, что ивакафтор обеспечивает оптимальные эффекты при 10 мкМ и имеет ЕС 50 100 нМ в клетках, экспрессирующих G551D CFTR. Взаимодействие с НБД является сложным и выходит за рамки данной статьи. Однако можно было бы ожидать, что применение обоих препаратов в этих концентрациях обеспечит либо сходный, либо сниженный CFTR-опосредованный транспорт Cl (большее насыщение ингибиторного сайта или конкурентный антагонизм), если бы активные сайты были идентичными.

Необходимы дальнейшие исследования, чтобы понять комбинированные эффекты ресвератрола и ивакафтора на G551D-CFTR, но наши результаты показывают, что объединение этих двух усилителей CFTR может дать улучшенный клинический эффект по сравнению с тем, что в настоящее время достигается с помощью одобренного FDA ивакафтора в этой популяции МВ.Действительно, CFTR-опосредованная секреция Cl в присутствии форсколина достигла уровней примерно 60% CFTR дикого типа в клетках FRT, а в первичном HSNE G551D / F508del фактически была аналогична по величине тому, что обнаруживается в первичной стимуляции форсколином. не-CF HSNE-клетки. К сожалению, ресвератрол демонстрирует плохую биодоступность с достижимыми максимальными уровнями в плазме примерно 2 мкМ, что значительно ниже оптимальной концентрации. 16 Однако множественные методы лечения МВ включают местное нанесение лекарств на носовые пазухи и легкие, включая гипертонический раствор, дорназу альфа и терапию антибиотиками. 33–35 В частности, пазухи являются отличной целевой областью для местных потенциаторов CFTR, вводимых в солевом растворе или аэрозоле. Таким образом, стратегии по местной доставке ресвератрола в пазухи или нижние дыхательные пути у лиц с G551D CF, которые уже принимают ивакафтор, безусловно, оправданы и требуют дальнейшей оценки.

ЗАКЛЮЧЕНИЕ

Дополнительное улучшение секреции Cl , опосредованной G551D CFTR, с помощью ресвератрола и ивакафтора предполагает различные механизмы и / или сайты связывания для этих усилителей.Планируются дальнейшие клинические исследования с использованием местной доставки ресвератрола в носовые пазухи для усиления терапии ивакафтором при СВС, ассоциированном с МВ, вызванным G551D.

Благодарности

Финансовая поддержка: Эта работа была поддержана Национальным институтом здравоохранения (NIH) / Национальным институтом сердца, легких и крови (1 R01 HL133006-02), Национальным институтом диабета, болезней органов пищеварения и почек (5P30DK072482) -05, CF Research Center Pilot Award) и грант CF Smackdown на семена BAW.

Сноски

Уровень доказательности: NA.

Раскрытие информации: Все авторы прочитали и одобрили рукопись. Д-р Брэдфорд А. Вудворт — консультант Cook Medical и Olympus. Устная презентация этой работы была представлена ​​на весеннем собрании Американского ринологического общества 19 апреля , 2018 г. в Балтиморе, штат Мэриленд.

СПИСОК ЛИТЕРАТУРЫ

1. Моллер В., Хауссингер К., Циглер-Хейтброк Л., Хейдер Дж. Мукоцилиарный и долгосрочный клиренс частиц в дыхательных путях пациентов с неподвижными ресничками.Respir Res. 2006; 7: 10. [Бесплатная статья PMC] [PubMed] [Google Scholar] 2. Accurso FJ, Rowe SM, Clancy JP и др. Эффект VX-770 у людей с муковисцидозом и мутацией G551D-CFTR. N Engl J Med.363 (21): 1991–2003. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Ван Гур Ф., Хадида С., Grootenhuis PD, et al. Восстановление функции эпителиальных клеток дыхательных путей при МВ in vitro с помощью потенциатора CFTR, VX-770. Труды Национальной академии наук Соединенных Штатов Америки. 2009. 106 (44): 18825–18830.[Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Брэдбери Н.А., Джиллинг Т., Берта Дж., Соршер Е.Дж., Бриджес Р.Дж., Кирк К.Л. Регуляция рециклинга плазматической мембраны с помощью CFTR. Наука. 1992. 256 (5056): 530–532. [PubMed] [Google Scholar] 5. Noone PG, Pue CA, Zhou Z и др. Заболевание легких, связанное с аллелем 5T IVS8 гена CFTR. Американский журнал респираторной медицины и реанимации. 2000. 162 (5): 1919–1924. [PubMed] [Google Scholar] 6. Noone PG, Zhou Z, Silverman LM, Jowell PS, Knowles MR, Cohn JA. Мутации гена муковисцидоза и риск панкреатита: связь с транспортом эпителиальных ионов и мутациями гена ингибитора трипсина.Гастроэнтерология. 2001. 121 (6): 1310–1319. [PubMed] [Google Scholar] 7. МакКоун Э.Ф., Эмерсон СС, Эдвардс К.Л., Эйткен М.Л. Влияние генотипа на фенотип и смертность при муковисцидозе: ретроспективное когортное исследование. Ланцет. 2003. 361 (9370): 1671–1676. [PubMed] [Google Scholar] 8. Virgin FW, Rowe SM, Wade MB и др. Обширное хирургическое и комплексное послеоперационное лечение хронического риносинусита с муковисцидозом. Американский журнал ринологии и аллергии. 2012; 26 (1): 70–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9.Спрингстил М.Ф., Галиетта Л.Дж., Ма Т. и др. Бензофлавоновые активаторы регулятора трансмембранной проводимости муковисцидоза: к фармакофорной модели нуклеотид-связывающего домена. Bioorg Med Chem. 2003. 11 (18): 4113–4120. [PubMed] [Google Scholar] 10. Галиетта Л.Дж., Спрингстил М.Ф., Эда М. и др. Новые активаторы хлоридных каналов CFTR идентифицированы путем скрининга комбинаторных библиотек на основе соединений свинца флавона и бензохинолизиния. J Biol Chem. 2001. 276 (23): 19723–19728. [PubMed] [Google Scholar] 11.Качи Э., Фолли С., Зегарра-Моран О. и др. Активация CFTR в эпителиальных клетках бронхов человека новыми соединениями бензофлавона и бензимидазолона. Am J Physiol Lung Cell Mol Physiol. 2003. 285 (1): L180–188. [PubMed] [Google Scholar] 12. Moran O, Galietta LJ, Zegarra-Moran O. Сайт связывания активаторов регулятора трансмембранной проводимости муковисцидоза в доменах связывания нуклеотидов. Cell Mol Life Sci. 2005. 62 (4): 446–460. [PubMed] [Google Scholar] 13. Мелин П., Торо В., Норез К., Билан Ф., Китцис А., Бек Ф.Мутация муковисцидоза G1349D в сигнатурном мотиве LSHGH NBD2 отменяет активацию хлоридных каналов CFTR генистеином. Biochem Pharmacol. 2004. 67 (12): 2187–2196. [PubMed] [Google Scholar] 14. Грей М.А., Гринвелл-младший, Аргент Б.Е. Регулируемый секретином хлоридный канал на апикальной плазматической мембране клеток протока поджелудочной железы. J Membr Biol. 1988. 105 (2): 131–142. [PubMed] [Google Scholar] 16. Sohma Y, Yu YC, Hwang TC. Куркумин и генистеин: комбинированное воздействие на ассоциированные с заболеванием мутанты CFTR и их клинические последствия.Curr Pharm Des. 2013. 19 (19): 3521–3528. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Бхаргейв Дж., Вудворт Б.А., Сюн Дж., Вулф С.Г., Антунес МБ, Коэн Н.А. Транзиторный рецепторный потенциал ваниллоидного канала 4-го типа при хроническом риносинусите. Американский журнал ринологии. 2008. 22 (1): 7–12. [PubMed] [Google Scholar] 18. Коэн Н.А., Чжан С., Шарп Д. Б. и др. Конденсат сигаретного дыма подавляет трансэпителиальный транспорт хлоридов и частоту биений ресничек. Ларингоскоп. 2009. 119 (11): 2269–2274. [PubMed] [Google Scholar] 19.Virgin FW, Азбелл С., Шустер Д. и др. Воздействие конденсата сигаретного дыма снижает транспорт активированного кальцием хлоридного канала в первичных культурах синоназального эпителия. Ларингоскоп. 2010. 120 (7): 1465–1469. [Бесплатная статья PMC] [PubMed] [Google Scholar] 20. Вудворт Б.А., Антунес М.Б., Бхаргейв Дж. И др. Носовые перегородки мышей для культур поверхности раздела воздух-жидкость дыхательного эпителия. Биотехники. 2007. 43 (2): 195–204. [PubMed] [Google Scholar] 21. Вудворт Б.А., Антунес МБ, Бхаргейв Дж., Палмер Дж. Н., Коэн Н. А..Эпителий трахеи и носовой перегородки мышей для культур на границе раздела воздух-жидкость: сравнительное исследование Am J Rhinol. 2007. 21 (5): 533–537. [PubMed] [Google Scholar] 22. Вудворт Б.А., Тамаширо Э., Бхаргейв Г., Коэн Н.А., Палмер Дж. Модель биопленок Pseudomonas aeruginosa in vitro на монослоях жизнеспособных эпителиальных клеток дыхательных путей Am J Rhinol. 2008. 22 (3): 234–238. [PubMed] [Google Scholar] 23. Zhang S, Fortenberry JA, Cohen NA, Sorscher EJ, Woodworth BA. Сравнение векторного переноса ионов в первичных культурах раздела воздух-жидкость из носовых пазух мышей и человека, модели для исследования муковисцидоза и других заболеваний дыхательных путей.Американский журнал ринологии и аллергии. 2009. 23 (2): 149–152. [PubMed] [Google Scholar] 24. Дин Н., Ранганат Н.К., Джонс Б. и др. Посевы носового эпителия свиней для исследования синусита при муковисцидозе. Международный форум аллергии и ринологии. 2014. 4 (7): 565–570. [Бесплатная статья PMC] [PubMed] [Google Scholar] 25. Конгер Б.Т., Чжан С., Скиннер Д. и др. Сравнение регулятора трансмембранной проводимости при муковисцидозе (CFTR) и активации частоты биений ресничек модуляторами CFTR Genistein, VRT-532 и UCCF-152 в культурах первичного синоназального эпителия.Отоларингология JAMA — хирургия головы и шеи. 2013. 139 (8): 822–827. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Типирнени К.Э., Грейсон Дж. В., Чжан С. и др. Оценка приобретенных дефектов мукоцилиарного клиренса с помощью микрооптической когерентной томографии. Международный форум аллергии и ринологии. 2017; 7 (9): 920–925. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Иллинг Э.А., Чо Д.Й., Чжан С. и др. Хлорогеновая кислота активирует CFTR-опосредованную секрецию Cl у мышей и людей: терапевтическое значение при хроническом риносинусите.Отоларингология — хирургия головы и шеи: официальный журнал Американской академии отоларингологии — хирургии головы и шеи. 2015; 153 (2): 291–297. [Бесплатная статья PMC] [PubMed] [Google Scholar] 28. Чжан С., Скиннер Д., Хикс С.Б. и др. Синупрет активирует CFTR и TMEM16A-зависимый трансэпителиальный транспорт хлоридов и улучшает показатели мукоцилиарного клиренса. ПлоС один. 2014; 9 (8): e104090. [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Bompadre SG, Sohma Y, Li M, Hwang TC. G551D и G1349D, две связанные с CF мутации в сигнатурных последовательностях CFTR, обнаруживают различные дефекты стробирования.J Gen Physiol. 2007. 129 (4): 285–298. [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Вудворт Б.А. Ресвератрол улучшает нарушения секреции жидкости и электролитов в модели приобретенного дефицита CFTR, вызванной гипоксией. Ларингоскоп. 2015; 125 Приложение 7: S1 – S13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31. Чжан С., Блаунт А.С., МакНиколас С.М. и др. Ресвератрол увеличивает глубину жидкости на поверхности дыхательных путей в эпителии носовых пазух за счет увеличения вероятности открытия регулятора трансмембранной проводимости при муковисцидозе.ПлоС один. 2013; 8 (11): e81589. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Ю. Ю., Мики Х, Накамура Ю. и др. Куркумин и генистеин усиливают действие G551D-CFTR. Журнал муковисцидоза: официальный журнал Европейского общества муковисцидоза. 2011; 10 (4): 243–252. [Бесплатная статья PMC] [PubMed] [Google Scholar] 33. Чиу А.Г., Антунес М.Б., Палмер Дж. Н., Коэн Н. А.. Оценка эффективности местного тобрамицина против синоназальных биопленок Pseudomonas sinonasal in vivo. J Antimicrob Chemother. 2007. 59 (6): 1130–1134.[PubMed] [Google Scholar] 34. Mainz JG, Schumacher U, Schadlich K, et al. Сино-назальная ингаляция изотонического раствора по сравнению с гипертоническим физиологическим раствором (6,0%) у пациентов с МВ и хроническим риносинуситом — результаты многоцентрового проспективного рандомизированного двойного слепого контролируемого исследования. Журнал муковисцидоза: официальный журнал Европейского общества муковисцидоза. 2016; 15 (6): e57 – e66. [PubMed] [Google Scholar] 35. Mainz JG, Schiller I., Ritschel C, et al. Синоназальная ингаляция дорназы альфа при МВ: двойное слепое плацебо-контролируемое перекрестное пилотное исследование.Auris Nasus Larynx. 2011. 38 (2): 220–227. [PubMed] [Google Scholar]

Активировать + стек форсколина? — Добавки — Форум по стероидам — ​​Форумы по анаболическим стероидам — ​​Обсуждение

кстати, ты делаешь жесткое кардио? Один из удивительных эффектов регулярного жесткого кардио — улучшение настроения и уменьшение депрессии. Это может облегчить любые боли, связанные с устранением lexapro. Еще один момент: пробовали ли вы SJW (St Johns Wort), если да, то каковы были для вас результаты?

Дж

Я бы не стал использовать слово «тяжелый», чтобы описать свой уровень кардио.Я занимался на эллиптическом тренажере 25 минут примерно 4 раза в неделю со скоростью 145-155 ударов в минуту. У меня проблемы с бегом из-за астмы. Между прочим, форсколин должен быть бронходилататором, поэтому будет интересно посмотреть, помогает ли он при кардио. На самом деле я не лечу астму, потому что она вызвана только физическими упражнениями (хотя в подростковом возрасте она была хронической).

Проблема не столько в депрессии, сколько в тревоге. В первую очередь, меня отправили в Док для Лекса, так это серия из 5 эпизодов панических атак в декабре 2003 года, когда я пошел в реанимацию, думая, что у меня случился сердечный приступ, 5 раз в течение 2 недель.Это, наряду с хронической тревогой (за вычетом панических атак) за последний год, заставило меня обратиться за лечением.

Тем не менее, я думаю, что кардио тоже помогает при тревоге, не говоря уже о том, что я толстый и мне все равно нужно это делать. SJW Я могу попробовать, если столкнусь с трудностями, но пока я думаю, что многие ужасные истории о ломке Lexapro — это раздутые случаи обратного плацебо или что-то в этом роде. (Стучит по дереву). У меня действительно не было проблем, но мне потребовалось 45 дней, чтобы перейти с обычных 10 мг в день до 2.5, так что это было очень постепенно.

Итак, отвечая на ваш вопрос, я не пробовал SJW. WRT анксилойтик, я принимаю 500 мг магния утром и 750 перед сном, таурин 500 мг утром и вечером (некоторые дозы намного выше, но в сочетании с магнием, для меня более высокая доза таурина приводила к более частым поездкам в туалет в экстренной ситуации, чем то, что есть идеальный), теанин по мере необходимости.

Я также принимаю пирацетам, Alpha GPC, ALCAR ежедневно и r-ala ежедневно.

Честно говоря, с тех пор, как я начал медленно отказываться от Лекса, я чувствую себя лучше, чем когда-либо, более ясным умом и т. Д.

Спасибо за вклад.

Forskolin body blast — forum — avis — en Pharmacy — prix — Amazon — состав | Блог Accueil

Programmez-moi une personne qui pourrait faire des Forskolin body blast soulevés avis de terre avec 225 кг, et je vous vous montrer un forum homme avec des jambes fortes et musclées, ainsi qu’un dos incroyablement musclé hypexpression avec du dos.Quelqu’un qui pourrait faire 100 кг de pressse militaire Forskolin body blast aura des épaules large et prix arrondies et n’aura absolument pas besoin de câble pour les ascenseurs latéraux.

Forskolin body blast — temoignage — состав — форум — avis

Si vous pouvez faire 150 кг приседаний на 20 повторов, состав Forskolin body blast avis vos jambes seront surement vraiment augmentées et vous n’aurez pas besoin de faire d’autres entraînements inutile pour les jambes com le développement des jambes.Si vous voyez des lacunes dans la masse композиция musculaire de ces gars, découvrez les concurrents masculins les plus forts du monde sur youtube et informez-moi. 4) Тенез подписал контракт с журналом по обучению и развитию, а также с прочностью и прочностью.

(c’est-à-dire en utilisant des poids meilleurs et plus élevés) — это структура централизованного управления массами. Ignorez cette idée et vous n’irez nulle part. Si vous faites 100 kg de squats maintenant, vous devez essayer d’utiliser 120 kg sinon 150 dans un an si vous souhaitez grandir.

Si vous ne maintenez pas un journal de vos Entraînements, forum Forskolin body blast temoignage vous ne saurez jamais si vous vous améliorez également car en plus vous oublierez absolument les objectifs que vous visez à forumatteindre. Gardez à l’esprit que vous ne pouvez pas augmenter le poids à chaque séance d’entraînement, de manière temoignage permanente. C’est difficile et si vous essayez de le faire, vous allz sureement vous blesser.

Forskolin body blast — prix? — où acheter — site du factory — sur Amazon — в аптеке

Vous aurez quelques jours de congé de temps en apitetemps, Forskolin body blast alors concentrez-vous sur ce vous ressentez réellement pendant l’entraînement et optez également for unleversion продолжительное.Gardez à l’esprit que si aujourd’hui vous pouvez soulever 42 кг за 10 повторений в военном прессе, вы можете получить более полную уверенность в своем корпусе плюс большие деньги на месте изготовления 10 повторений за 75 кг.

  • Легкость экструдера. 5) Entraînez-vous avec prix? 70 à 85% de votre plafond La base, les séries faites avec un poids indiqué
  • ici на 70% от вашего плафона, который не является стимулом, достаточным для генерального развития мышечной ткани.Cela montre que si vous pouvez soulever 90 кг (tout
  • simplement dès que possible), лоты подходят для сбора от 65 до 75 кг.

Все упражнения, выполненные на весу 65 кг, взятые на Амазонку, учитываются как домашнее движение, так и не подходят для генерации давления и количества. Il s’agit d’un type de «zone grise», des résultats vraiment exceptionnels sont obtenus malgré une collecte от 50 до 60%, является уникальным, так как не вызывает vitesse idéale и avec également de l’endurance.

Tout ce qui est fait autour de 80–85% est généralement Forskolin body blast utile для устранения большей части стимула круассанса и прочной прочности при предварительном воспроизведении коллекции, это значит, что вы не прошли предварительную проверку волокон. Musculaires activables. Pour la plupart des gens, cet effet est obtenu avec 5 à 8 associés, que je je considère com le nombre associated pour ceux qui n’utilisent pas de composés ou de medicaments, un compte héréditaire dans la moyenne et souhaculine également lagalement a .

Взрыв тела форсколина — командир — офицер — оф. Трувер — Франция

Après cela, à la fin de l’entraînement, для élever le France Forskolin body blast or punver «pompage musculaire», vous pouvez faire un entraînement avec 9–12 repétitions (et même 15–20 avec 70% du plafond). Cela garantira absolument l’activation de toutes les fibres musculaires pratiques. 6) Ne faites pas plus de 12–16 où per entraînements au total dans une séance d’entraînement Si vous vous Entraînez correctement et si vous savez que vous devez devenir plus puissant si vous voulez France увеличивает быстрое наращивание мышечной массы.

Vous désirez créer 3 на 5 кг чистой мышечной массы. Vous désirez избегайте больших размеров, des bras musclés и des pectoraux toniques. L’entraînement et aussi la food sont un mélange unissocional Mirco Schöning Manager des Ventes d’Atlantic Multipower, 12 лет в Бундеслиге американского футбола (grand récepteur et aussi sécurité) élevé, c’est très bien.

Néanmoins, afin d’atteindre votre objectif, vous devez site officiel Форсколин, командир подрыва трупа, изменник за режим питания с официальным местом расположения.Управление для «упрощения» возбуждения для мышечной ткани, для развития и увеличения давления на производство всех необходимых питательных веществ. Les mille dédicaces exigeantes de nos journées nous amènent à Absorber des plats pauvres en Nutrition.

Forskolin body blast — pas cher — mode d’emploi — achat — comment utiliser?

Cette pénurie crée le corps inquiet pour attaquer ses achat Forskolin body blast pas cher публикации et plutôt que de construire des musculaires, il les endommage.Nos affaires — combinées à une form corrective — pourraient vous aider à arrêter cette отрицательное влияние. «Le corps peut transformer achat l’excitation procurée par pas cher l’entraînement en croissance musculaire simplement en prenant la Quantité Соответствующие энергии и питательные вещества sous form de protéines saines et équilibrées et de glucides».

Принята программа по обучению водолазам, участвующим в обучении водолазов, и наращивание мышечной массы с базовыми навыками, приобретенными, массовыми мышцами и выносливостью.

  • Suivez un régime alimentaire qui cible l’amélioration de la masse musculaire, et envisagez également de prendre des Suppléments qui vous aideront
  • уверенность в красоте плюс стремительность мускулов.

Голосовые методы для начала. Методика 1 mode d’emploi Forskolin body blast comment utiliser? Сохранение фотографий роботов и твердых тел Гагнера, а также больших мышц и игр. Режим действий 1 1 Верифье за ​​развитие.Lorsque vous beginncez à gagner de l’endurance en même temps que de la masse musculaire, gardez à l’esprit le nombre de kilos que vous soulevez, qu’est-ce que comment utiliser? cela vous fait perdre? Poids que vous pourriez augmenter, ainsi que les упражнения que vous effectuez chaque semaine.

Резюме

Cela y a-t-il effets secondaires? vous aidera à posologie comprendre exactement quelles test sont les meilleures méthodes d’entraînement pour votre corps et vous permettra également de ne pas vous retrouver dans une pierre d’achoppement.doctissimo Si vous constatez qu’une équipe musculaire ne s’améliore pas, changez la method d’entraînement pour voir si un autreercise vous donne avis consommateur sur forum
de meilleurs avis Medical client resultats.

Forskolin — co to jest, działanie, tabletki, skutki uboczne

Форсколин шутка субстанция отжимиван з покрживы индийский. Warto sięgnąć po suplementy z tym składnikiem, ponieważ wspomagają odchudzanie, ale i leczenie raka.

Фильм Зобача: «Pokrzywa [Wirtualna Poradnia]»

1. Ко шутить форсколин?

Forskolin to roślinny związek diterpenowy zawarty w pokrzywie indyjskiej. To wieloletnie ziele rośnie głównie w klimacie subtropikalnym Azji Południowo-Wschodniej. W krajach europejskich pokrzywa indyjska często służy jako roślina ozdobna.

Działanie forskolinu wykorzystywane było już bardzo dawno w naturalnej medycynie hinduskiej oraz ajurwedyjskiej.Ekstrakt z pokrzywy indyjskiej stosowano wówczas przeciwbólowo i przeciwzapalnie. Roślina pomagała także w problemach ze snem, sercem oraz w dolegliwościach związanych z układem oddechowym, krążeniowym i moczowym.

2. Działanie forskolinu

Forskolin zawarty w pokrzywie indyjskiej przynosi wspaniałe korzyści zdrowotne. Liście zioła stosowane są głównie w leczeniu przeziębień, kaszlu, astmy, zapalenia płuc oraz w chorobach skóry takich jak odleżyny i inne rany.

Czynna subsza ukrwienie tego gruczołu, przez co stymuluje jego pracę.

Forskolin skutecznie sprzyja obniżeniu ciśnienia krwi, a także wpływa na lepszą pracę serca. Może, więc służyć, jako środek do wspomagania leczenia chorób kardiologicznych.

Mężczyźni, którzy mają проблемы с андрогенами, czyli гормоны płciowymi powinni spróbować forskolinu. Ten roślinny związek poprawia nastrój, ma wpływ na podniesienie libido, wzmaga siły witalne i działa antydepresyjnie.

Substancję roślinną zawartą w pokrzywie można także stosować profilaktycznie w nowotworach, ponieważ może zahamować przerzuty choroby. Forskolin szczególnie poleca się w leczeniu przerostu prostaty, ponieważ łagodzi raka gruczołu krokowego. W przyszłości ten związek może być brany pod uwagę jako składnik nowej terapii w onkologii. Na razie jednak nie przeprowadzono oficjalnych badań, które zainicjowałyby takie działania.

3. Дополнение на одчудзание

Forskolin stosowany jest jednak głównie, jako suplement na odchudzanie.Ta subcja sprawia, że ​​tłuszcz zawarty w tkance tłuszczowej zostaje szybciej rozłożony w naszym organmie. Preparat uzyskiwany z pokrzywy indyjskiej jest więc odpowiedni dla ludzi zmagających się z dodatkowymi kilogramami.

Na rynku aptecznym popularne są suplementy, w których znajduje się zmielony korzeń pokrzywy indyjskiej. Czasami do kapsułek dodawany jest też kwas rozmarynowy i inne wspomagajce subcje lecznicze. Można także kupić tabletki z wydzielonym forskolinem .

Suplementy z forskolinem powinno się zaywać zgodnie z informacjami na opakowaniu lub na Recepcie. Zwykle шутка jedna dawka dziennie.

Rekomendowane przez naszych ekspertów

4. Skutki uboczne zażywania forskolinu

O skutkach ubocznych zażywania forskolinu wiadomo niewiele. Та субстанция dzięki swojemu roślinnemu pochodzeniu jest jednak dość bezpieczna i może być codziennym dodatkiem do diety.

Na tego typu suplementy powinny jednak uważać dzieci i kobiety w ciąży.Forskolin może przyczynić się do poronień i tworzyć większe prawdopodobieństwo krwotoków w tak ważnym dla kobiet czasie, gdyż działa przeciwzakrzepowo.

Nie czekaj na wizytę u lekarza. Skorzystaj z konsultacji u specjalistów z całej Polski już dziś na abcZdrowie Znajd lekarza.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *